The template strand of a gene has the sequence 5' CTAGTTGGCACACTCCATGGT 3'. Starting from the start codon, what is the third amino acid incorporated into the polypeptide chain

Q: Which mRNA strand is complementary to this template DNA strand: 5’-CTGCAT-3’? 3’-AUGCAG-5’…

A: Template strand is the strand of DNA molecule on which the mRNA is synthesized. Complementary strand…

Q: Which of the following could be the mRNA codon, the codon on the DNA sense strand, and the codon on…

A: DNA => Transcription => mRNA => Translation => Protein. In DNA: 5' - 3' strand is called…

Q: A template strand in bacterial DNA has the following base sequence: 5′ –AGGTTTAACGTGCAT–3′ What…

A: Bacterial DNA is contained within the bacterial chromosome along with several RNA and protein…

Q: The DNA sequence contains the complete sequence for a small gene. What amino acid sequence does this…

A: DNA sequence of genes code for the sequence of amino acids in proteins. There are two strands in…

Q: Which of the following point mutations is likely to be the worst for an organism if they happened in…

A: Mutation is a change in genetic sequence or genomic sequence of an organism. This change can be…

Q: Explain the process translation. A complete answer will include the words below tRNA, amino acid,…

A: The translation is the process of amino acid change of protein synthesis from the mRNA sequence. The…

Q: Which of the following mutations would be more detrimental to an organism? 1) a mutation that…

A: Mutations are the alterations in the DNA that can happen either due to internal factors like…

Q: During Codon recognition (a) the ribosome moves towards the 3’ end of the mRNA   (b) a tautomeric…

A: A codon is the three-nucleotide stretch of sequence which codes for proteins. In central dogma, it…

Q: What is the name of the nucleotide sequence that helps the 30S ribosomal (small) subunit find the…

A: Translation initiation proceeds through the capture of mRNA by the 30s ribosomal subunit in…

Q: The wobble position of a codon can sometimes vary without changing the amino acid. is where RNA…

A: Introduction The third base of the codon is called as wobble position of a codon. tRNA is the…

Q: . How many codons are there above in question 8? Label one of them in green.

A: Hello. Since you have posted multiple questions and not specified which question needs to be solved,…

Q: Which of the following is a true statement concerning codons  A codon Will be read by RNA…

A:

Q: In this sequence there are two introns and three exons. Exon 1 has 3 amino acids, exon 2 has 4 amino…

A: Once a gene is transcribed into a pre-mRNA transcript containing both coding (called as exons)…

Q: Fill in the following information for making the following polypeptide (the codon chart is below).…

A: The sequence of nucleotides in DNA or RNA makes up the genetic code. Codons are three-base groups…

Q: In the genetic code, there are ___ More tRNAs than codons  More codons than amino acids  The same…

A: The DNA is transcribed into and mRNA sequence by the process of transcription. RNA contains three…

Q: Select all that apply: Beginning at the 5' end of the DNA, which answer choices place a gene's…

A: Gene or DNA is the basic mode of transfer of inheritance from one organism to another (parents to…

Q: Which of the following base pairings are allowed between an anticodon and the 3' base of a codon,…

A: According to wobble hypothesis, the third nucleotide of anticodon is a wobble and can base pair with…

Q: Which of the following MRNA sequences codes for the polypeptide sequence tyrosine-leucine-alanine?…

A: The mRNA is a single-stranded molecule of RNA that corresponds to the genetic sequence of a gene.…

Q: What will be the sequence of mRNA produced by the following stretch of DNA? 3' ATCGGTTAAC 5'…

A: Transcription is the process of synthesis of an RNA molecule from the DNA template strand. Where RNA…

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy-ribose nucleic acid whereas…

Q: Which of the following describes a silent mutation that is undetectable in the final protein…

A: Mutation can be outlined as the variation within the sequence of DNA. It generally occurs as a…

Q: Look carefully at the illustrations for gene translation. What mRNA codon specifies the tRNA…

A: As the illustration for the gene translation is not given. we are providing all the possible codons.

Q: The template strand of a gene contains the following sequence: 3'-TAC TTG TCC GAT ATC-5' Following a…

A: Introduction A mutation is a change in the sequence of nucleotides in DNA or RNA. Everyone is…

Q: gene contains 141 codons. How many nucleotides are present in the gene’s coding sequence? How many…

A: A codon is an amino acid corresponding trinucleotide sequence of DNA or RNA. The genetic code…

Q: The exons and introns of a gene are shown below. Introns are shown as black bars. Exons are numbered…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: If the following piece of DNA were used as a template for transcription, what would the sequence of…

A: Transcription the process in which RNA is formed out of the DNA the processing that is translation.…

Q: Consider the following segment of a template strand of DNA: Part A -АТА AGC TTC GAC What is the MRNA…

A: Transcription is the process of making an RNA copy of a gene sequence known as mRNA by using DNA as…

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…

A: Deoxyribonucleic acid (DNA) is a double-stranded, a self-replicating material that is present in…

Q: Which of the following is the anti-codon present on the t-RNA that carries fMet to the start codon?…

A: a. The start codon is the first codon of a messenger RNA transcript that is translated by a…

Q: A strand of DNA, TACGCT, serves as a template for mRNA transcription. What would be the correct…

A:

Q: How many initiation codons are there?   a. 1   b. 3   c. 4   d. 20

A: Genetic codon or triplet codon basically serves the function of protein translation. Ribosomes are…

Q: Part of the protein-coding region in a gene has the base sequence 3-…

A: Gene  Gene is the part of DNA which code for polypeptide chain.

Q: The nucleotide triplet AAA is the codon for Lysine. This codon originated from the following piece…

A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…

Q: Which of the following statements best explains why there are many more codons than there are amino…

A: The genetic codon is the sequence of three successive nucleotides present in the mRNA that codes…

Q: result

A: Transition mutation is nothing but the replacement of one purine nucleotide with other and one…

Q: What is the effect of the insertion of a nucleotide in the 4th codon of the DNA sequence below?…

A: There are two strands of DNA :- template and coding strand . Template strand read in 3' to 5'…

Q: A particular triplet of bases in the coding sequence of DNA is AAA. The anticodon on the tRNA that…

A: If the template strand of DNA has AAA, it will be transcribed to mRNA as UUU. A tRNA that would…

Q: multiple codons (genetic code triplets)

A: Cells decode mRNAs by investigating their codons. Every codon indicates a type of amino acid, or, at…

Q: Which three codons would code for a different amino acid sequence from that coded for by the mRNA…

A: Given: mRNA base sequence: AGU-UCA-CCA Have to determine which three codons will code for a…

Q: If instead of 20 amino acids there were 200 amino acids, then how many nucleotides would you be…

A: An mRNA directs the insertion of single amino acid to a protein per three nucleotides. A codon is a…

Q: Finally, imagine that a mutation occurred in the codon below and an A was inserted between the two…

A: a mutation occurred in the codon below and an A was inserted between the two Ts T  T  G chnages to T…

Q: If the base sequence on one DNA strand is ATGGCCTAG, what is the sequence on the other strand of the…

A: In order to make the complementary strand we have to look on following things:- DNA → DNA adenine →…

Q: Which of the following is an example of the degeneracy of the genetic code An amino acid can have…

A: There are total 64 combinations of base pairs that is needed to code 20 main amino acids  so more…

Q: In this picture, a tRNA is already bound to the initiator codon at the start of the mRNA strand. The…

A: The central dogma states that the genetic information will flow from DNA to RNA and then to protein,…

Q: Here is a DNA template strand’s sequence and direction: 3’-TACGCGGTAATC-5’ . What is the sequence…

A: The deoxyribonucleic acid (DNA) undergoes the process of transcription for synthesizing the…

Q: The following is a part of the sequence on DNA template strand. 5' ATGGCCCGGTAAGTA 3' Write the…

A: A codon is a sequence of three consecutive nucleotides in a DNA or RNA that codes for a specific…

Q: A particular triplet of bases in the template strand of DNA is 5' AGT 3'. The corresponding codon…

A: ANSWER;- 3'UCA 5' Explain;- Transcription is a process of a particular DNA sequence being copied…

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…

A: DNA consists of two intertwined polynucleotide strands: coding strand and template strand. The…

Q: Which of the following is the complementary MRNA sequence to a DNA gene with the sequence 3'…

A: DNA is the basic unit of inheritance. DNA contains genes which are transcribed to messenger RNA and…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.