the restriction enzyme NotI recognizes the following sequence : 5'-GCGGCCGC-3' . On average, how oftern should this enzyme cleave DNA?

Q: Which of the following sequences is most likely to be recognized and cut by a 6- cutter restriction…

A: Restriction enzyme is an enzyme that cuts DNA into small fragments at specific sites within…

Q: For the following short sequence of double stranded DNA, design primers (just ~ 3-4 bases) and show…

A: Polymerase (PCR) chain reaction is a process in which small DNA fragments are amplified into a…

Q: Which of the following ingredients does not belong in a sequencing reaction? (A ddNTPs B Primer C…

A:

Q: Transcribe and translate the following DNA sequence (nontemplate strand): 5'-ATGGCCGGTTATTAAGCA-3'

A: Transcription is a process in which one strand of DNA known as template strand is known as converted…

Q: The restriction enzyme Alu I cleaves at the sequence 5’-AGCT- 3' , and Not I cleaves at 5'…

A: Restriction enzymes or restriction endonucleases are endonuclease enzymes capable of recognizing a…

Q: In this diagram representing the steps of PCR (Polymerase Chain Reaction), yhich letter represents…

A: When DNA is heated to 95 degree Celsius denaturation of DNA occurs .

Q: Some restriction endonucleases produce blunt-ended pieces of DNA, while other produce DNA fragments…

A: DNA (deoxyribonucleic acid) is the unit of an organism. The DNA is inherited from the parent…

Q: The restriction enzyme BamHI recognizes the sequence GGATCC and cuts the DNA between the two G’s.…

A: Ans: Restriction enzymes: The enzymes which cuts the DNA at specific site and used in cloning is…

Q: Depending upon the chemical nature of the template (DNA or RNA)and the nature of nucleic acids…

A: Nucleic acid polymerases are the enzymes that plays a crucial role in replication of genome, gene…

Q: EcoR1 is a restriction enzyme that cuts DNA at the following base sequence: 5' GAATTC 3' Which…

A: The restriction enzyme cuts the DNA at the specific recognition sequence.

Q: The total (50ul) of your restriction digest contains 500ng of DNA how much DNA (ng) are you loading…

A: The amount of DNA extracted depends on the sample's quality and the number of cells in it.…

Q: Most prokaryotic organisms produce one or more enzymes to defend themselves against the infection by…

A: Bacteria constitute a wide domain of prokaryotic microbes with majorly varying lengths and a number…

Q: Which of the restriction enzymes listed in the table below produces blunt-end fragments? Enzyme…

A: The blunt end are produced by the restriction enzymes when the end of a DNA fragment  after breaking…

Q: A molecule of double-stranded DNA that is 5 million base pairs long has a base composition that is…

A: Let us consider the probability of finding the restriction sites in DNA at any position is '1 in x',…

Q: DNA ligase

A: The correct option is Option 3. DNA ligase

Q: Which of the following DNA pol I activities would be MOST important in the removal of the primer? A…

A: The DNA polymerase I has two actions: - Synthesis of Okazaki fragments to complete gaps. 5/ to 3/…

Q: Choose the combination of answers that most accurately completes the statement.Which of the…

A: Restriction endonuclease or restriction enzyme is a type of enzyme used in cloning studies. It is…

Q: The restriction endonuclease NotI recognizes the octanucleotide sequence GCGGCCGC. Calculate the…

A: Restriction endonucleases are enzymes that cut DNA sequences at a specific site known as a…

Q: A 3000 bp circular DNA was treated with both HindIII and EcoRI restriction enzymes. EcoRI cuts at…

A: In this question, we are given two restriction enzymes EcoRI and HindIII with their restricting…

Q: The 50ul of your restriction digest contains 500ng of DNA how much DNA (ng) are you loading into the…

A: DNA yield (µg) = DNA concentration × total sample volume (ml) Usually  we need : Restriction…

Q: Which of the following sequences, when combined with itscomplement, would be clipped by a…

A: Restriction endonuclease is also known as restriction enzymes that are produced by the bacteria.…

Q: During proofreading, which of the following enzymes reads the DNA? a. primase b. topoisomerase c.…

A: BASIC INFORMATION  DNA  it stands for deoxyribo nucleic acid.  it is the genetic material of all…

Q: If a restriction enzyme cuts between the G and the A whenever itencounters the sequence GAATTC, how…

A: Answer is c.) four.

Q: Assuming a circular piece of DNA (plasmid) was used as starting material, how many restriction sites…

A: Restriction enzymes are specific endonuclease that can cut a DNA at a particular sequence.…

Q: A molecule of double-stranded DNA that is 5 million base pairs long has a base composition that is…

A: If a molecule of double-stranded DNA which is 5 million base pairs long, has a base composition that…

Q: The recognition site for Spel is A'CTAGT. Which of the following restriction sites when digested…

A: Restriction site - Each restriction enzyme identify specific sequence of nucleotide, known as…

Q: GAATTC GAATTO CITAAG CITAAG double-stranded DNA DAATT DAATTO CTAA G CTAA GI AAT TO CTTAA GAATTO…

A: The cloning is routinely used in biotechnology laboratories and it is the process by which a foreign…

Q: A purified piece of DNA of 1650bp is cut with Hind III and Pst I separately and then with both…

A: Restriction enzymes are endonucleases derived from bacteria that make a double-stranded cut in the…

Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATT CCCGGTATA", what is its complementary…

A: DNA (deoxyribonucleic acid) is a double-stranded nucleotide sequence that is intertwined and…

Q: Which of the following is most likely to be a restriction enzyme recognition sequence? O AAAAAA O…

A: A palindromic sequence is a sequence of nucleic acids within double helix of DNA and / or RNA that…

Q: Another restriction enzyme is called HaellI. It cuts DNA at the following base sequence: CCGG GGCC…

A: restriction enzymes are those enzymes which helps in cutting dna at specific locations .

Q: Enzymes that catalyze DNA denaturation or melting are:   gyrases   topoisomerases   helicases…

A: DNA is a genetic material that is a double stranded structure polymer of nucleotides. DNA…

Q: Dr. Doom has a DNA sequence of 2000 bp. Enzyme X and Enzyme Y restriction sites and their positions…

A: Restriction enzymes are the enzymes which cut DNA at particular site.

Q: If you wanted to create recombinant DNA using this enzyme(3' T A 5'), would you have to cut both…

A: DNA recombination is a technology in which DNA from different sources is isolated and recombined to…

Q: Explain why it is necessary that DNA is replicated continuously on the leading strand by but…

A: Introduction :  Direction of DNA replication is 5' - 3' .  Primase add primer and DNA polymerase…

Q: Name the enzymes that cut the DNA at specific sequences and create sticky ends.

A: A substance produced by a living organism that acts as a catalyst to bring about a specific…

Q: The Watson-Crick double helix immediately suggested that DNA is replicated in a manner. a. semi…

A: The genetic material is transmitted to the next generation through DNA. A cell leads to several more…

Q: Which of the following does the enzyme primase synthesize? a. DNA primer b. RNA primer c. Okazaki…

A: Primer RNA is RNA that initiates DNA synthesis. Primers are required for DNA synthesis because no…

Q: This piece of DNA is cut by EcoRI, the resulting fragments are separated by gel electrophoresis, and…

A: The restriction endonucleases are also called molecular scissors as they cut the DNA fragments at…

Q: Some restriction enzymes produce DNA fragments with overhanging stretches called sticky ends on each…

A: A restriction enzyme, is an enzyme that cleaves DNA into fragments at or near specific recognition…

Q: A molecule of double-stranded DNA that is 5 million base pairs long has a base composition that is…

A: The types of nucleotide bases of the genetic material are the same in all the species present on…

Q: The partial sequence of one strand of a double-stranded DNA molecule is5′ – – –…

A: Restriction enzymes also called molecular scissors are originally a part of a bacterial defence…

Q: Restriction sites are palindromic; that is, they read the same in the5' to 3' direction on each…

A: Restriction enzymes also called molecular scissors are originally a part of a bacterial defence…

Q: For the chromatogram below, what is the sequence of the template DNA from base 115 to 125? CTGTGTGAA…

A: DNA is formed of four types of nitrogenous bases, which are adenine, thymine, guanine, and cytocine.…

Q: When lambda DNA is cut with HinDIII what is the size in base-pairs of the smallest restriction…

A: Restriction enzyme cuts the DNA at specific recognition site. These are palindromic in nature.

Q: Which of the following sequences in double-stranded DNA is most likely to be recognized as a cutting…

A: Restriction enzymes are also known as molecular scissors because they cut the DNA at specific, short…

Q: The restriction endonuclease NotI recognizes the octanucleotide sequence GCGGCCGC. Calculate the…

A: restriction endonuclease is an enzyme that cuts DNA sequences at specific sites.

Q: The restriction enzymes Kpn I and Acc 65I recognize and cleave the same 6-bp sequence. However, the…

A: Introduction: Enzymes are proteins that serve as biological catalysts and increase the rate of the…

Q: Restriction mapping of a linear piece of DNA reveals the following EcoRI restriction sites. EcoRI…

A: Introduction By cleaving the internal covalent bonds between nucleotides, endonucleases breaks down…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.