Q: Under neutrality, what are possible explanations for why a plece might be evolving more slowly than…
A: What is mutation ? Changes in the DNA sequence that can be occurred by mutagens, infection etc.…
Q: - Which organs do mammals and butterflies have in common in the reproductive tract? - What organs…
A: The reproductive system of the silkmoth Bombyx mori comprises gonads, accessory glands, and paired…
Q: The term LD 50 refers to the concentration of a drug or chemical that will kill 50% of the…
A: 0.005 ppt, 5000 ppb. When reporting medication concentrations, parts per million (ppm) or parts…
Q: based on the pedigree shown,the most likely pattern of inheritance is?
A: A pedigree is a family tree that represents genetic family history. It is a visual tool for…
Q: Explain the reason for which the concentration of actin to be 50-100 times greater than the critical…
A: The actin filaments are made up of two helical strands of F-actin and two helical strands of…
Q: After genetic selection, some originally diploid species can become triploid, like for example some…
A: Triploidy is referred to as 3n, with 1n is the haploid chromosome number for the species in…
Q: Which of the following is NOT an appropriate use of DNA Sequencing data. a. Comparing the…
A: DNA sequencing refers to the process of identifying the base sequence of DNA. It uses sophisticated…
Q: How lateral association promotes the subsequent rapid formation of a microtubule.
A: Introduction: The hollow, cylindrical nature of the microtubules. They have a diameter of around 25…
Q: In pea plants, smooth peas is dominant to wrinkled peas. When Mendel crossed true breeding smooth…
A: Let us assume the dominant smooth character of peas is represented by (S) while the recessive…
Q: Explain where the protein disulfide isomerase (PDI) would be expected if ER retrieval signal is…
A: The membrane flow between components is balanced by the retrieval pathway. This reverses the…
Q: Explain the order of action of Frizzled and Dishevelled in the signaling pathway.
A: Frizzled is a receptor of - wnt protein signal (mammals) Wingless protein (Drosophila) MOM2…
Q: The presence of chiasmata indicates that two non-sister chromatids_________________ are not…
A: A replicated chromosome with two daughter strands connected to a centromere can be called a…
Q: A plant breeder found a species of flowering plant with very attractive flowers growing wild in a…
A: Given that, there is one type of plant species, but with three different colours of flowers. The…
Q: explain pathogenesis of edema
A: What is edema? Soft tissue expansion, or edema, is caused by a rise in extracellular fluid. The…
Q: Who would win in a fight to the death?... A Neanderthal or a biologically modern human? Homo sapiens…
A: Introduction: The protracted process of change that separated humans from their apelike forebears is…
Q: Question 10 10. Consuming cruciferous vegetables can help lower your risk for cancer. True False
A: Please follow steps 2,3 & 4 for detailed explanation.
Q: Question 18) Very early onset PSEN2 mutations have a more severe impact on the Aß 42/40 ratios than…
A: Alzheimer's Disease is a progressive, neuro-degenerative disease that leads to almost 70 percent…
Q: In this case a family history revealed a genetic basis for the disorder. The pedigree is shown in…
A: Traits are classified into two types: autosomal and sex-linked traits. Autosomal traits are…
Q: PKU Worksheet Read the following paragraph about a genetic disorder identified as an inborn error…
A: Genetic disorder: When there are single or multiple abnormalities in the genome, it can lead to…
Q: Which of the following is NOT a ribonucleoprotein (protein-RNA complex)? Select an answer and…
A: Option (b) - RNA polymerase II is not a ribonucleoprotein. RNA polymerase II is an important…
Q: what is a hominin fossil that discusses contrasting perspectives (lumper vs. splitter) of taxonomic…
A: The hominin fossil is the fossils of the Hominini subfamily which includes the Homo and Pan groups…
Q: Describe the natural defence mechanisms used to protect individuals from urinary tract infections…
A: INTRODUCTION Urinary tract infections (UTIs) are one of the great concerns in the medical field as…
Q: What benefit does the process of metamorphosis play in insect reproduction? - Do moths undergo…
A: Insects are winged invertebrates (lack backbone) belonging to the class Insecta. These possess some…
Q: Arrange the following structures and vessels in the correct order in which lymph would flow from a…
A: Lymph is the excess tissue fluid that is collected by the lymphatic vessels. Lymph and lymphatic…
Q: What conclusions concerning the relationship between sucrose concentration, temperature gradient and…
A: Introduction: In order to create usable energy, oxygen and energy molecules are chemically combined…
Q: How do we improve or harm or gut flora?
A: Gut flora includes the microbes that are found in our digestive tracts. These are different species…
Q: "Mutations that are inherited according to Mendelian rules affect nuclear genes; mutations whose…
A: Gene mutation is the complete change in the DNA sequence that creates a gene, which differs from the…
Q: Which of the following statements are correct about tumor cell masses (select all that apply)? A.…
A: B. Most stromal cells are of mesenchymal origin. C. Fibroblasts, macrophages and lymphocytes are…
Q: Discuss Voges Proskauer test for listeria monocytogenes, give the principles, reagents used if…
A: Principle of Voges-Proskauer test The Voges-Proskauer (VP) test is used to examine whether a…
Q: What brain region(s) is/are responsible for inhibiting muscle tone in the neck and core during REM…
A: The tension in a relaxed muscle or the resistance seen by the examiner during passive stretching of…
Q: In pea plants, the dominant allele for flower color is yellow (Y), and the recessive allele is white…
A: A monohybrid cross is a cross in which one character is considered at a time. In this cross,…
Q: What new symptoms do you predict if the following exotoxins appeared in a new bacteria? Explain why…
A: 1. A lower respiratory (lung) bacteria with the Cholera Toxin Predicted Symptoms a) Low potassium…
Q: Given the food web below where predator preferences are indicated using strong (thick arrow) and…
A: Competition coefficient mean the inhibitory effect of one species over another.
Q: 1)Provide a scientific example of evolution and/or natural selection. You can use human and/or…
A: Speciation occurred as a result of evolution. The new species begin to reproduce their offspring.…
Q: Color-blindness is an X-linked recessive disorder. Under what circumstances will this condition…
A:
Q: Which of the following is not a post-translational modification? Select an answer and submit. For…
A: Please follow step 2 for detailed explanation.
Q: QUESTIONS: What pathogen caused the disease? What is the morphology and staining characteristics of…
A: The case described above shows that the patient is suffering from Diphtheria. This is an illness in…
Q: What is the expected molecular weight of the protein encoded by the sequence provided here:
A: A protein is formed by various amino acids linked together by peptide bonds. By knowing the number…
Q: The glia limitans is produced by _____ _____ and forms a barrier associated with the ______ basal…
A: The neuroglial/glial cells and neurons are the cells that form the nervous system. The glial cells…
Q: Which of the following describes the concentration of K+ and Na+ ions in and around a resting…
A: An action potential is an electrical signal that travels along the surface of a cell. This signal is…
Q: Determine which statement(s) are true/false NK cells are a type of lymphocyte involved in acquired…
A: Immunity to a disease is achieved through the presence of antibodies to that disease in a person's…
Q: The gel matrix impedes the movement of [ Select] ["smaller", "larger"] DNA molecules while allowing…
A: Gel electrophoresis is a molecular technique used to separate fragments of DNA molecules based on…
Q: Explain why the infamous letter that Dr. Cornelius Rhoads triggered an investigation against him. He…
A: Ans. Option 5) In a letter published in 1932 and initally written in November 1931 Dr. Rhoads had…
Q: INTERPRET THE DATA IN THE GRAPH - Line graph comprises of horizontal axis and vertical axis . -…
A: A gene pool gains new alleles through mutations. This alters the population's frequency of…
Q: E. What are the possible genotypes of the gametes you would expect from Parent 2 (indicate the ratio…
A: As we can provide answer to limited questions. I'm providing answers to first two options i.e e…
Q: Even though plants and animals independently evolved multicellularity, they use virtually all the…
A: Animals and plants are both eukaryotes, yet they have different evolutionary histories. They each…
Q: Match the protein on the left with the nucleotide triphosphate on the right that it binds. Keratin…
A: Introduction Proteins are very complex molecules that perform a variety of important tasks in an…
Q: You have isolated a temperature-sensitive cell-cycle mutant. The mutated gene encodes the activating…
A: Cell division is the sequential process in which parent cell divides and redistribute their genetic…
Q: What is the anatomy of a virus
A: Introduction: Viruses are microscopic parasites often substantially smaller than bacteria. They are…
Q: Discuss the early and late associative effects in the cellular processes of neurons that occur as a…
A: Early & late associative effects in cellular processes of neurons are - learning and memory. *…
Transcribe the following piece of DNA.
DNA 5’ GCGATGCCCTAGGTATGA 3'
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- show the findings (DNA extraction-gel band; NO/YES) and briefly explain the interpretation of the resultsUse the gel to answer the following questions. You will be constructing a map of the plasmid, pDiddy. What is the largest fragment size that the BamHI/NcoI double digest produces? 2.250 kb 2.500 kb 2kb 750 bWrite down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT
- Can you help me to explain these dna model because i have recitation tomorrowPlease draw the structure of DNA and label the parts. Thank you very much for your help.View the given linked video to see the detailed structure of the different kinds of DNA. After analyzing make a simple illustration to relate the different kinds of DNA to its function. https://www.youtube.com/watch?v=o_-6JXLYS-k