Translate and transcribe the following DNA molecules DNA:AATACGGGGGCGTAACCACTA mRNA: amino acids:

Q: What molecules do the following digestive enzymes help to break down? (a) amylase, (b) invertase,…

A: Introduction :  Catalysts speed up chemical reactions without getting consumed or getting changed…

Q: A plant species has flowers that can be red, pink, or white. Flower color is controlled by one gene…

A: Hardy weinberg principle is given by G.H Hardy in 1908.This principle states that in the absence of…

Q: Which type of stimuli is represented by a stressor such as a pop quiz or a knock on the door in the…

A: A stress reaction is triggered by any mental or physical stimulus that throw off equilibrium. Stress…

Q: self pollinated and 320 seeds are subsequently collected a

A:

Q: Identify the genotypes

A: Autosomal dominant - Characteristics of autosomal dominant inheritance: 1. A gene is dominant if it…

Q: How do tissue cells look in comparassion to cheek cells using H&E staining?,.

A: INTRODUCTION A tissue cell is a specialized type of cell that makes up the various types of tissues…

Q: DNA is comprised of four different bases. What are the four different bases? What is so significant…

A: Introduction : The full form of DNA is deoxyribose nucleic acid. It carries genetic information from…

Q: Refer to the figure.  a. What gene mutation(s) will result in the loss of production of the sepals?…

A: A typical flower is composed of four whorls. Flowers are the organs of sexual reproduction in…

Q: ow can i use a resourse for this?

A: 1. Stomach: The stomach has specialized circular and longitudinal muscles that aid in the process of…

Q: State all the farming techniques or technologies farmers use to grow a sweet potato and why sweet…

A: Farming requires hard work and techniques as it is a complex process that involves a variety of…

Q: 6. What is the term for the number of offspring a population could produce if no limits were placed…

A: "Since you have posted multiple questions, we will provide the solutiononly to the first question as…

Q: Using function as the discriminating feature, draw up a dichotomous key to distinguish the 4 cells…

A: A dichotomous key for immune cells is a tool for identifying and classifying various types of immune…

Q: 5) Why is blood type inheritance an example of both codominance and complete dominance?

A: The blood is the connective tissue composed of plasma, formed elements such as erythrocytes,…

Q: PLEASE I REALLY NEED HELP. Explains how the endocrine system works. What are the different types of…

A: Homeostasis is essential for maintaining overall health and well-being, allowing the body to respond…

Q: Is the whole protein (destined for the ER) synthesized and then moved to the ER or is it synthesized…

A: Introduction:- Protein molecules are the polymers of amino acids. Amino acids are linked with each…

Q: The Okazaki fragment is formed     a)  near the replication fork.   b)  on the lagging strand.…

A: According to the definition, DNA fragments created during DNA replication is called Okazaki…

Q: 5-Hepatitis ________ is a DNA virus   A-A   B-B   C-C     D-H

A: An inflammation of the liver is known as hepatitis. The problem may go away on its own or worsen…

Q: Draw/Show Pyrolobus fumarii and label its parts.

A: Pyrolobus fumari is an archea which is a prokaryote. Being an archaea, it is able to survive at very…

Q: Would it be more difficult to meet a 70 ppb one hour averaged standard or 70 ppb 8-hr averaged…

A: The National Ambient Air Quality Standards (NAAQS) are set by the US Environmental Protection Agency…

Q: How is electrochemical immunosensors can treat cancer ? What is the role of electrochemical…

A: Cancer is a disease characterized by the uncontrolled growth and spread of abnormal cells in the…

Q: Why is it important for healthcare professionals in the United States maintaining current knowledge…

A: An outbreak is a rapid increase in the number of cases of a disease within a particular area or…

Q: muscles

A: Homeostasis refers to the body’s ability to physiologically regulate its inner environment to ensure…

Q: What herbal structural features do all connective tissues share in common

A: Introduction Tissue is defined as a group of cells that perform a specific function. There are four…

Q: Chi-square analysis to determine whether you are correct as to the genotype of the unknown…

A: Hypothesis: The genotype of the unknown individual is homozygous recessive (aa). Degrees of Freedom…

Q: PART A. Redraw the table below on the whiteboard. Use your Biological Molecules Part 2 handout to…

A: Lipids and DNA are biomolecules or macromolecules which are made up of monomers. For example, lipid…

Q: Need. help with c and d please, thank you!

A: The graph depicts the influence of glycosylation on the CD4 receptor on HIV infectivity in human and…

Q: 10. Create and Design your Own Experiment: a. Give a basic layout of the experiment: what are you…

A: We must determine the topic and area we should construct a hypothesis for before creating an…

Q: A cell undergoing division has a haploid chromosome number of 15. Give the numerical value for each…

A: Since you have asked multiple sub parts, we will solve first three sub parts for you. If you want…

Q: Explain how the advancements in modern technology influence the performance of today's medical…

A: The advancement and innovation in modern technologies provide huge benefits for clinical trials and…

Q: You are studying a biochemical pathway that requires ATP as an energy source. To your dismay, the…

A: ATP is used as the energy currency of the cell. It is mainly produced by the aerobic cellular…

Q: Identify infective stage, route of exposure, definitive host, intermediate host using a parasitic…

A: Plasmodium falciparum is a malarial parasite that involves two different hosts in its life cycle.…

Q: 52. Which of the following describes the benefits of free-range grazing for meat production?…

A: Free-range grazing is a method of raising livestock in which the animals are not confined to a…

Q: Study the following questions: 1. Define the terms: transcription, promoter, enhancer, terminator.…

A: Transcription is the process of converting genetic information from a DNA molecule into an RNA…

Q: 2). In rabbits, coat colour patterns are determined by 3 alleles at one locus. Agouti is dominant…

A: There are certain genes which have more than two alleles. A condition in which trait is controlled…

Q: There is a non-harmful species of fly that has a body coloration pattern that is similar to bees and…

A: It's important to note that mimicry is not always a perfect adaptation, and there are many factors…

Q: GIARDIA LAMBILA , Ascaris lumbricoides are common parasites found in Guyana and discuss the…

A: Introduction  There are many life forms that are pathogenic to humans. Some live as a parasite…

Q: ext/map/ aining Lab Report Place the descriptions into the correct boxes to test your understanding…

A: Gram staining is a method frequently used to distinguish between two sizable groups of bacteria…

Q: 10) 0.031709792 11) Convert one million seconds to years. (1 yr with 365 days) 12) Convert 12 liters…

A: These are conversions.  In order to convert a numerical value from one unit to the other one should…

Q: Part1: What is the difference between Mitosis and Meiosis? - GIve a detailed answer. Part2: Create a…

A: Mitosis and meiosis are the two ways that continue to divide and multiply. Meiosis produces four…

Q: Two true-breeding pea plants are crossed. One parent is round, terminal, violet, constricted, while…

A: A tetra hybrid cross is a type of genetic cross that involves the inheritance of four different…

Q: Pre-lab task 3: List the general characteristics of fungi, animals and plants and based on those…

A: Introduction : Taxonomy is the systematic approach to naming and categorizing all of the various…

Q: Beadle and Tatum removed arginine and other substances from the nutrient medium of the mutated…

A: Beadle and Tatum experimentally proved the "one gene one enzyme" hypothesis. They took wild-type…

Q: lased on the oxygen binding correct statement: O₂ saturation (%) ४ 8 88 8 80 40 20 0 Myoglobin…

A: The correct statements can be identified as follows- a. The sigmoidal binding curve of haemoglobin…

Q: Connective Tissue: Cell Types: (Short Answer Questions) Describe the three (3) types of cells and…

A: Since you've asked multiple questions, we're only answering the first three for you, if you want any…

Q: Homeostasis is the ability of the body to Selected Answer: Answers: keep conditions in the internal…

A: Human biology covers every element of the human body, such as evolution, genomics, ecosystem,…

Q: Why is it important to have control experiments in addition to the tests being conducted? a.To…

A: Control experiments are extremely important when conducting scientific tests and experiments. They…

Q: . True or False: Alpha cells secrete glucagon, which causes cells to release stored glucose into the…

A: Alpha cells, located in the pancreas, are an important part of the body's endocrine system. They…

Q: For many years, wetlands were considered to be "wasted land", where 50% of wetlands in the U.S.…

A: Wetlands are the places where the soil is covered by water either salt or fresh. It may be…

Q: State is the nutrional value of the barley in terms of carbohydrates, proteins and fats? Why barley…

A: introduction: One of the oldest cereals in existence, barley was initially grown in Southwest Asia…

Q: 40 Listen Imagine that each year, 40 tons of fish meal are provided as food to captive fish in a…

A: The correct option is: 4 tons

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.