If one DNA segment has the following base composition, 5'-CAGTTAGTCA-3', which of the following sequences is complementary? 5'-TGACTAACTG-3' 3'-TGACTAACTG-5' 3'-CAGTTAGTCA-5' 3'-TGACTAACTG-5'
Q: What is the polypeptide that will be formed from the following DNA sequence? Template DNA…
A: In molecular biology complementary base pairing or complementarity is a reletion between the two…
Q: Which of the following is correct according to the DNA base-pairing rules? O a. A+Gequals C+T O b.…
A: DNA or deoxyribonucleic acid is the genetic material found in most eukaryotes. It carries the…
Q: Which 2 primers will copy the entire sequence of DNA: 5'…
A: Primer is a short nucleotide sequence which is required to initiate DNA replication . To the primers…
Q: What is the role of alcohol in extracting DNA? 1.DNA is a polar molecule with an overall negative…
A: DNA extraction is a process involve disruption and lysis of the cell followed by the removal of…
Q: Which of the following sequences would be complementary to a DNA strand with the sequence…
A: Complementarity refers to a relationship between two structures each following lock and key…
Q: Which of the following is correct according to the DNA base-pairing rules? O a. A= G O b. A= C O c.…
A: Nucleotide bases are arranged in a proper sequence. There are four nucleotide sequences out of which…
Q: Look at the double-stranded segment of DNA shown below. Imagine that the two strands have already…
A: DNA is the nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid in which…
Q: If you had the RNA sequence below: 5' UUUGGAG3 and you were going to make a piece of DNA that would…
A: Uracil is the unique base in RNA, whereas in DNA it is thymine.. The strands runs antiparallel; one…
Q: How many fragments are produced if ddT is added to the following DNA segment during Sanger…
A: DNA is arranged in a specific sequence of nucleotides. The sequence consists of four types of…
Q: CT/TGT/AAG/ACC/TTT What would be the amino acid sequence created from this mutated DNA strand?
A: The central dogma theory in genetics is based on the processes of Replication, Transcription and…
Q: A K I D H
A: Deoxyribonucleic acid (DNA) is a biomolecule found in nearly all living organisms. The structure of…
Q: 1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: At a specific area of a chromosome, the sequence of nucleotides below is present where the chain…
A: Replication is the process of making of daughter DNA from the parental DNA.
Q: The DNA sequence ATGCATGC will pair with which of the following DNA strands? TACGTACG TACCTACC…
A: DNA, or deoxyribonucleic acid, is the hereditary material in humans and virtually all other…
Q: 1. a) If one DNA segment has the following base composition, 5'-CAGTTAGTCA-3', which of the…
A: I Double stranded DNA the base pairing between the strands occurs as follows: A pairs with T and G…
Q: If the following piece of the partially double stranded DNA: 5' ATCG 3' 3' TAGCGGCATCCG 5' and…
A: Given: A piece of the partially double-stranded DNA: 5' ATCG 3' 3' TAGCGGCATCCG 5' and add DNA…
Q: A portion of one strand of DNA has the sequence 5′ AATGGCTTA 3′. If this strand is used as a…
A:
Q: DNA Polymerase Holoenzyme Il is represented below. It consists of several domains with distinct…
A: At the replication fork, DNA polymerase III holoenzyme (Pol III HE) works with the helicase and…
Q: Of the following DNA sequences which would you expect to have the highest melting temperature in its…
A: Melting temperature is defined as the temperature at which a double-stranded DNA molecule will break…
Q: During DNA replication, the template sequence 5' ATAGGCC 3' would produce which one of the following…
A: Replication is a biochemical process by which the DNA is synthesized on itself. It is mode by which…
Q: Sanger DNA sequencing/ dideoxy sequencing was used as shown in the diagram below. The arrow…
A: Sanger's sequencing method. It is a method based on DNA synthesis. In normal DNA synthesis,…
Q: Show the structure of a DNA where the lead strand is ATCG. Show H-, glycosidic, phosphoester…
A: DNA is Nucleic acid that consists of two strands that run in opposite directions. One of the stand…
Q: For numbers 1-3 refer to the statement: The following is the base sequence on one strand of a DNA…
A: "Since you have asked multiple questions, we are eligible to answer only the first three parts.…
Q: Which of the following would represent a section of DNA with a palindromic sequence? 5' TAT CCG 3'…
A: A palindromic sequence is a nucleic acid sequence in a double-stranded DNA or RNA molecule which on…
Q: DNA that has been labeled with 15N is used as the template for replication. Replication is carried…
A: Watson and Crick proposed that the double-strand DNA (dsDNA) replication is a semiconservative…
Q: Is each of the following mutations a transition, transversion, addition,or deletion? The original…
A: Since no specific subparts have been asked to be answered, the first three subparts have been…
Q: The sequence of the DNA template strand is 3’–ATGGCAATAC–5’: What is the sequence of the DNA…
A: DNA stands for Deoxyribonucleic acid. It is a molecule that comprises two polynucleotide chains.…
Q: Which of the following is true about the denaturation of double-helical DNA? A. Denaturation…
A: The hydrogen bonds between DNA strands weaken and eventually break when the temperature of a DNA…
Q: DUE IN 30 MINUTES. This is multiple choice. No need for explanation, answer only. Thank you! A…
A: Basic amino groups (-NH2) and carboxyl groups (-COOH) are found in amino acids. Proteins have amino…
Q: Produce the complimentary DNA strand that would be matched with the provided strand T--A C--G C --G…
A: A complementary strand of DNA is constructed based on base complementarity. Complementarity is…
Q: The single strand of DNA below forms a stem-loop structure structure with a loop that is 6…
A: The answer will be b) 5' CTACGATA 3' As in this option 5 nucleotides from 3' end are complimentary…
Q: If you have five test tubes each containing a double stand DNA, which of the following double…
A: Answer- The denaturation of DNA is depend on the melting temperature and the composition of the…
Q: a. As a result of the structure of DNA and RNA, replication, transcription and translation are…
A: Since you have posted a question with multiple sub-parts, we will solve the first three subparts for…
Q: . The DNA polymerases are positioned over the following DNA segment (which is part of a much larger…
A: Introduction DNA replication is very crucial process for the continuation of life as every new…
Q: Given the following template DNA strand, what is the correct complementary DNA sequence? 3' CGC AGT…
A: Nucleic acids are present inside the nucleus to store and pass genetic information and thus controls…
Q: Which of the following pairs of base sequences could form ashort stretch of a normal double helix of…
A: Deoxyribonucleic acid (DNA) is the hereditary material present in humans and almost all organisms.…
Q: In bacterial cells, nucleotide excision repair involves which of the following proteins? A. DNA…
A: DNA A deoxyribonucleic acid polymer that present in the nucleus and carry genetic information.
Q: true or false: Bases pair up quickly on the leading strand, however, the bases have to be filled in…
A: The semiconservative DNA replication scheme proposed by Watson and Crick states that when the double…
Q: The following sequences of DNA would be synthesized using 5′-CAGTTCGGA-3′ as a template: *…
A: DNA is synthesized in 5' to 3' direction.
Q: Which of the following DNA sequence pairs are completely complementary? Group of answer choices…
A: Answer In DNA, Adenine (A) pairs with Thymine (T) and Guanine (G) pairs with Cytosine (C). Hence, on…
Q: Here is a DNA coding strand’s sequence and direction: 5’-ATGCCGATATAG-3’ . What would be the amino…
A: For the synthesis of protein first template strand of DNA is made from coding strand of DNA.…
Q: single strand binding proteins are important for this activity prevent replication of the ends of…
A: Single strand binding protein (SSB) are a type of protein found in both viruses and microorganisms…
Q: Given the following template DNA strand, what is the correct complementary DNA sequence? 3' CGC AGT…
A: DNA has a double helix structure composed of sugar, phosphate group, and four nitrogen bases.…
Q: What is the nucleotide sequence of the DNA strand that is complementary to 5'-GGCGCAACTGTCACAA-3'
A: A nucleic acid sequence is a set of five letters that indicates the order of nucleotides in a DNA or…
Q: If the template DNA sequence is 3' - CCC - ATA - GAG - AAA - 5' , then what is the corresponding…
A: DNA is molecule which is present inside a cell and contain the genetic information of an individual…
Q: Which of the following statements about polynucleotide formation is correct? As a polymer, DNA is…
A: Polynucleotides The word polynucleotides can be split into two words "poly" which means "many" and…
Q: If part of a gene had the base sequence TGC CAT, what would be the base sequence of the…
A: DNA (Deoxyribonucleic acid) is one of the nucleic acid elements which contains the genetic…
Q: What size DNA fragment would be released after very mild digestion of chromatin with micrococcal…
A: Introduction Micrococcal nuclease in as example of endo-exonuclease which is obtained from…
Q: Which of the following statements is true for double-stranded DNA? O All of the given choices are…
A: All cellular lifeforms have DNA as their genetic material. A double stranded DNA (dsDNA) is composed…
If one DNA segment has the following base composition, 5'-CAGTTAGTCA-3', which of the following sequences is complementary?
5'-TGACTAACTG-3'
3'-TGACTAACTG-5'
3'-CAGTTAGTCA-5'
3'-TGACTAACTG-5'
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- 1. a) If one DNA segment has the following base composition, 5'-CAGTTAGTCA-3', which of the following sequences is complementary? op 1: 3'-CAGTTAGTCA-5' op 2: 3'-TGACTAACTG-5' op 3: 5'-TGACTAACTG-3' op 4: 3'-TGACTAACTG-5' b) What is the nucleotide sequence of the DNA strand that is complementary to 5'-ATCGCAACTGTCACTA-3' op 1: 5'-TAGCGTTGACAGTGATA-3' op 2: 5'-TAGTGACAGTTGCGAT-3' op 3: 5'-ATCACTGTCAACGCTA-3' op 4: 5'-UAGUGACAGUUGCGAU-3'Which of the following would represent a section of DNA with a palindromic sequence? 5' TAT CCG 3' 5' GGA CTT 3' 5' TTT CCA 3' 5' CAT ATG 3'. The DNA polymerases are positioned over the following DNA segment (which is part of a much larger molecule) and moving from right to left. If we assume that anOkazaki fragment is made from this segment, what will be the fragment’s sequence? Label its 5′ and 3′ ends. 5′.…CCTTAAGACTAACTACTTACTGGGATC….3′ 3′.…GGAATTCTGATTGATGAATGACCCTAG….5′
- Given the following template DNA strand, what is the correct complementary DNA sequence? 3' CGC AGT GGA CAT TTC 5'Which of the following pairs of base sequences could form ashort stretch of a normal double helix of DNA?(A) 5′-AGCT-3′ with 5′-TCGA-3′(B) 5′-GCGC-3′ with 5′-TATA-3′(C) 5′-ATGC-3′ with 5′-GCAT-3′(D) All of these pairs are correctWhich of the following sequences is the best description of the complementary DNA sequence to the following sequence: 5'-CGATTAGC-3' Group of answer choices 5'-GCTAATCG-3' 5'-GCUAAUCG-3' 3'-CGATTAGC-5' 3'-GCUAAUCG-5' 3'-GCTAATCG-5'
- If the template DNA sequence is 3' - CCC - ATA - GAG - AAA - 5' , then what is the corresponding daughter strand sequence? A. 3' - GGG - TAT - CTC - TTT - 5' B. 5' - GGG - TAT - CTC - TTT - 3' C. 3' - GGG - UAU - CUC - UUU - 5' D. 5' - GGG - UAU - CUC - UUU - 3'Write down the double stranding sequence of the resulting DNA fragment(s) if the following DNA molecule were digested with XhoI: 5'-GGTATCCGCGGAGCTCAAATA-3' 3'-CCATAGGCGCCTCGAGTTTAT-5'Give the corresponding strand of the DNA having the sequence of:a. 5’ ATGGCTAGGATCGGTAACTGCGATCGATCAGCATGACTAG-3’b. 3’ TACCAGGATAATTCGAGGTACTACGACTAGGAT-5’c. 5’ AACATGATCTGGTCCATTAGCTTGTTCAATAATTAGC-3’
- What is the sequence of the newly synthesize DNA segment if the template strand has the following sequence:3'-ATGGCCTATGCGAT-5'Which of the following DNA sequence pairs are completely complementary? Group of answer choices 5’-AGTCTTAGC and 5’-GCTAAGACT 5’-CTGACCTGG and 5’-GGTCCAGTC 5’-TTGATGACC and 5’-TTGATGACC 5’-GAGCTAATA and 5’-GAGCATTATWhich of the following represents a missense mutation in the DNA coding strand sequence, 5' - AAACCTTTT - 3'? a) 5' - AAACCCTTT - 3' b) 5' - AAACCATTT - 3' c) 5' - AAACGTTTT - 3' d) 3' - AAACCTTTT - 5' e) 5' - AAACCGTTT - 3'