Unlike cytotoxic T lymphocytes, NK cells do not _____. (Select all that apply.) a. secrete cytokines b. participate in the adaptive immune response c. rearrange T-cell receptor genes d. use MHC class I molecules for their development and function e. express CD3 components.
Q: Osmosis is how excess salts that accumulate in cells are transferred to the blood stream so they can…
A: Osmosis is how excess salts that accumulate in cells are transferred to the blood stream so they can…
Q: 1. Female Drosophila with cinnabar eye (cn) and vestigial wings (vg) were mated to males with roof…
A: Test cross is a cross between F1 individual and recessive individual. By crossing the F1 individual…
Q: discuss potential benefits as well as potential disadvantages of Eugenics for humanity.
A: Eugenics,also called as human genetic engineering, changes or removes genes to prevent disease,…
Q: Some substitution mutation result in a malfunctioning protein but others do not. Why is this?
A: A mutation is a change that occurs while copying or trying to replicate DNA molecules, resulting in…
Q: What is the principle behind a UV-Vis spectrophotometer, and what are its key components, and how…
A: UV-vis spectrophotometry or UV spectroscopy types of absorption spectroscopy or reflectance…
Q: Which of the following is most likely to be an RNA nucleotide? a. Adenosine-5'-triphosphate b.…
A: A nucleic acid is a linear polymer of nucleotides that is a component of the cell's information…
Q: Why is bush encroachment a common characteristic between Sweet and the Sour veld, veld types whereas…
A: A veld which is also commonly known as veldt is large landscape that is open and flat. Perennial…
Q: The probability of having an individual with a least a heterozygous gene pair on its genotype from…
A: The two genes are involved in this case. That's why it is a case of dihybrid cross.
Q: A series of two-point crosses were carried out among five loci (E, F, G, H, and I), producing the…
A: When two genes are near enough on the same chromosome, they are considered to be connected because…
Q: HO HH C-N-C -C- OH R +H20 H H C-N-C N-C OH OH H. R. The chemical reaction illustrated in the…
A:
Q: Poverty and hunger drive people to bear more children. a) True b) False 35 0
A: Not 100 % true but it true...
Q: Metalloprotein linkages are most likely to be formed between: a.Two cysteines b.An arginine and a…
A: Metalloprotein linkages are most likely to be formed between?
Q: The erythrocyte sedimentation rate (heaviness) testis oftenusedfor a blood sample as a diagnosis of…
A: Erythrocyte sedimentation rate: The erythrocyte sedimentation rate (ESR or sed rate) is the rate at…
Q: What is the specific molecule recognized in our ELISA to measure phospholipase C activity? How is it…
A: Snadwisch ELISA method can be to measure phospholipase c activity can detect the level of PLCG2…
Q: Based on the milkfish dissection, describe the structure of skull and vertebral column design. How…
A: Answer :: Milkfish (Chanos chanos) is the only fish species that belongs to Family Chanidae which is…
Q: Describe the four membranes in the avian egg. How does EACH membrane affect the developing embryo?
A: Avian egg development.
Q: - Coronary arteries route oxygen rich blood into the tissues of the heart. of the: d. descending…
A: Two major coronary arteries branch off from the aorta. They branch off from a point where aorta…
Q: What are 4 mutualistic and 4 antagonistic interaction between two or more species that are exploited…
A: Four mutualistic interactions- 1. Aphids and ants- Aphids are sap-sucking insects that exude…
Q: What are the functions of ovaries in a flowering plant?? A. TO PRODUCE FEMALE GAMETES B. TO PRODUCE…
A: ovary, in flowering plants is enlarged basal portion of the pistil, the female organ of a flower.
Q: Cancer is classified with the type 1 of DM True False
A: The kidneys are bean-shaped excretory organs and it is the main organs of the urinary system as it…
Q: If a phage is undergoing lytic growth, which protein is bound to the operator region? O Both Lambda…
A: INTRODUCTION Lytic stage of phage This is the reproductive stage of bacteriophage it include 6…
Q: The sodium pump is an example of a catabolic process. an anabolic process. stored energy. a. b. C.…
A: The sodium-potassium pump is an example of an active transport membrane protein/transmembrane…
Q: B. The illustration shows the stages of development in human embryo. 2 CELL EGG 4 CELL EGG…
A: Introduction Life starts from single cell called zygote. Zygote is single diploid cell resulted…
Q: Describe the probable root system of a crop that has been applied with frequent, light, and widely…
A: The probable root system would be that the root is not too deep it is spread in shallow areas of the…
Q: In a chemical reaction catalyzed by an enzyme, the enzyme: O becomes the substrate is destroyed does…
A: Enzymes Enzymes are biological catalysts that speed up the rate of the biochemical reaction. Most…
Q: C-A-G-T-T-A-A-G-G-C-T-C-C-T-A-G-G-T-T-A 5' i. What would be the first 5 bases at the 3' end of the…
A: 3' C-A-G-T-T-A-A-G-G-C-T-C-C-T-A-G-G-T-T-A 5' Complementary strand- 5'- CTCAATTCCGAGGATCCAAT-3' i)…
Q: Each of the animal cells shown below is ina different stage of mitosis. Select the cell that is…
A: Mitosis is the process in which the sister chromatids separate from each other and move to opposite…
Q: Are humans a land-sharer Or land-sparer? Why?
A: Land-sharing systems and Land-sparing systems are two contrasting approaches to sustainable living.
Q: The O-antigen is part of the bacterium's which is found in the outer membrane of some bacterial cell…
A: Introduction Antigen:- These are any substance that causes the body to make an immune response…
Q: QUESTION 4 In fruit flies, white eyes (we) and miniature wings (mw) are encoded by two mutant…
A: The test cross is given in this question. The crossing occurs between the unknown parent with…
Q: Aside from cleanliness and access to clean water, propose scientific ways in controlling parasitic…
A: Parasitic diseases These are diseases that are caused by a parasite. These are infectious diseases…
Q: nscript: 3' TACAGTTAAGGCTCCACTGTTA 5' 5' 3' ino Acid Sequence (ex. Met-Trp- and so on) Second letter…
A: The genetic code is the relationship between the sequence of bases in DNA and the sequence of amino…
Q: 4. Describe the process of alternation of generations using any plant phylum as an example. In your…
A: Introduction :- In plants and algae, the most common type of life cycle is generational alternation.…
Q: In a eukaryotic cell, the majority of the organelles are located in the: cell wall O coelom…
A: Eukaryotes are cells that are complex in structure and function As they have the membrane bound…
Q: The diagram below represents results of agarose gel electrophoresis performed after PCR…
A: Please follow step 2 for detailed explanation.
Q: DNA Sequence Enter DNA sequence below Original sequence ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG…
A: DNA contains the genetic information about the characteristics features of te organism present in…
Q: You are investigating the loss of activity of a particular enzyme in a mutamt bacterium. You…
A: The activity of an enzyme is micromoles of product formed per minute. The enzyme interacts with to…
Q: Instruction: Using the data on the situation below, compute for the Hardy-Weinberg equation to…
A: Here the orange goldfish crackers are dominant & the white goldfish crackers are recessive. The…
Q: Describe how ecology affects evolution. Provide an example in which the ecological interaction…
A: Ecology is the inter relationship between the biotic community and abiotic environment. Because it…
Q: The intracellular matrix differs from the extracellular matrix in that the latter is located A…
A: Q. The intracellular matrix differs from the extracellular matrix in that the latter is located A…
Q: Rapidly dividing cells such as bone marrow, skin, intestinal mucosa, and cancer cells need DNA…
A: Cancer is a disease defined by the uncontrolled development of a group of abnormal cells that can…
Q: How does RhoGAM prevent HDN? A) it is an antigen that binds to and inactivates anti-Rh antibody from…
A: Introduction Antibody:- It is a protein made by plasma cells (a type of white blood cell) in…
Q: Gestation takes about -____weeks. a) 38-42 b) 44-46 c) 28-30 O d) 48-52
A:
Q: Consider the similarities and differences in the reproductive cycles (haplontic, diplontic, and…
A: All these life cycles are based on the haploid and diploid phases. This is called alternation of…
Q: Please discuss the value of international normalized ratio (INR) as a test. Why do you think this is…
A: PT test is the normal blood test conducted to record the time taken for blood to clot.
Q: How does RhoGAM prevent HDN? A) it is an antigen that binds to and inactivates anti-Rh antibody from…
A: Introduction Rho(D) immune globulin is made up of antibodies to the antigen Rho(D) present on some…
Q: Here is a family pedigree for an imprinting disorder caused by a loss of function mutation in a…
A: A) In the pedigree chart we can see that : Carrier father can pass on the genetic defect to his…
Q: 1. What are the amino acids translated from the resulting mRNA?
A: The process of transcription occurs only in one strand of the double-stranded DNA. This strand is…
Q: Scientists have discovered a new species of bird in Mexico that migrates South to the Amazon…
A: The process of animals migrating over great distances in search of food and shelter, as well as to…
Q: If a phage is undergoing lytic growth, which protein is bound to the operator region? O Both Lambda…
A: In this Particular question we have to describe about regulation of lytic cycle.
| Unlike cytotoxic T lymphocytes, NK cells do not _____. (Select all that apply.) |
| a. secrete cytokines |
| b. participate in the adaptive immune response |
| c. rearrange T-cell receptor genes |
| d. use MHC class I molecules for their development and function |
| e. express CD3 components. |
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- To become a fully activated, antibody-secreting cell, B cells usually need: a. to encounter an antigen or receive a signal delivered by a helper T cell. b. to ingest a foreign invader such as a microobe. c. activation by a plasma cell d. contact with an antigen and helper T cell cytokinesActivated helper T Cells participate in which of the following processes? a.) Differentiation of memory B cells b.) Activation of cytotoxic T Cells c.) Facilitation of macrophage phagocytosis d.) All of aboveThe binding groove of endothelial protein C receptor (EPCR) binds to _____ and presents them to _____. a. phosphoantigens; Vγ9:Vδ2 T cells b. MIC-A or MIC-B proteins; NK cells c. sulfatides; Vγ:Vδ1 T cells d. phospholipids; Vγ4:Vδ5 T cells e. lipid antigens; Vα24–Jα18:Vβ11 NKT cells.
- Why is the secondary immune response so much stronger than theprimary response?a. Because high concentrations of antibodies are already presentb. Because the phagocytes present the antigens more rapidlyc. Because memory B cells can rapidly convert to plasma cellsd. Because protein synthesis occurs more quickly in memory cellsAntibody-mediated immunitya. works best against intracellular antigens.b. regulates the activity of T cells.c. cannot be transferred from one person to another.d. is responsible for immediate hypersensitivity reactions.To become a fully activated, antibody-secreting cell, B cellsusually need:(a) To encounter an antigen or receive a signal delivered bya T helper cell(b) To ingest a foreign invader such as a microbe(c) Activation by a plasma cell(d) Contact with an antigen and T helper cell cytokines
- What is the function of the blood-thymus barrier?a. It protects maturing T-lymphocytes from antigens inthe blood.b. It filters the blood and starts an immune response whennecessary.c. It subdivides the thymus into a cortex and a medulla.d. It forms thymic corpuscles.Explain why each choice (a-d) is correct or incorrect. T cells are differentiated into two groups based on their glycoproteins CD4 or CD8. Which of the following is true of CD4 T cells? a. They become cytotoxic T cells. b. The become antigen presenting cells. c. They become T helper cells. d. They become plasma cells.Which of the following pairs is mismatched? a. plasma cell: mediation of phagocytosis and killing of microorganisms in the plasma b. megakaryocyte: formation of platelets c. dendritic cell: activation of adaptive immune responses d. natural killer cell: develops from a common lymphoid progenitor e. neutrophil: formation of pus f. regulatory T cell: inhibition of T-cell activity.
- Identify each immune response as either humoral (H) or cellular (C). A. release of histamine causes itching & sneezing B. cytotoxic T lymphocytes kill infected cells C. plasma B cells are cloned D. antibodies mark pathogen’s antigens E. cytokines signal B & T cell production F. macrophage presents antigen to the matching receptor on helper T cellWhich of the following is NOT true of Innate Lymphoid Cells (ILCs)? A) Each ILC type responds to a different category of pathogens. b.)) ILCs are derived from the common lymphoid precursor. c. )) ILCs rearrange their antigen receptors in a similar way to T-cells. d. ))Each ILC type is distinguished by the cytokines that it produces. e. ))Development of each ILC type is driven by unique transcription factors.A person who has received a vaccine for human papillomavirus (HPV), which causes genital warts and can cause cervical cancera. is able to produce antibodies against HPV.b. is more susceptible to HPV than someone who has not had the vaccine.c. has nonspecific immunity against HPV.d. must already been infected with HPV. Which of the following leukocytes can be classified as lymphocytes?a. B cellsb. T cellsc. Natural killer cellsd. all of the above
