Scientists have discovered a new species of bird in Mexico that migrates South to the Amazon rainforest to breed. How wouldthis migration behavior be studied? B. Propose an exoeriemt to Test the function of these migratory neurons in birds brain

Q: 4. Mr. Salazar has Type A blood while Mrs. Salazar has Type B. They have four children. Bobbie has…

A: Given -  Blood type of Mr Salazar - A Blood type of Mrs Salazar - B Therefore, Possible genotypes of…

Q: DNA Sequence Enter DNA sequence below Original sequence ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG…

A: DNA  contains the genetic information about the characteristics features of te organism present in…

Q: Which of the following would NOT leac protein denaturation? A. A pH change B. A covalent compound C.…

A: In biology, denaturation is the modification of a protein's molecular structure. Many of the weak…

Q: 30-40% of all type 1 DM patients develop nephropathy in years

A: Diabetes can cause diabetic neuropathy, which is a kind of nerve injury. High blood sugar (glucose)…

Q: A galactosidase from E. coli has a molecular weight of 650 000 Da and a molar extinction coefficient…

A: Given values Molecular weight of galactosidase= 650000Da. Molar extinction coefficient (e) = 1.3 x…

Q: ANSWER THESE QUESTION; Click Edit DNA and make a substitution mutation that changes the first base…

A: Original sequence- ATG CCA GGC GGC GAG AGC TTG CTA ATT GGC TTA TAG Edited sequence- changes the…

Q: To examine: Whether the statement "protein tyrosine phosphatases display exquisite specificity for…

A: Protein phosphatases (PPs) regulate a wide range of signalling systems in plants, and their blockage…

Q: 2. The image above represents a simple cladogram for the primate order, where the letters are nodes…

A: Grasping hand and foot are observed in each primates, grasping foot is absent in humans most…

Q: Indirect bilirubin water insoluble * True O False The ALP are a group of enzymes that hydrolyse in…

A: Bilirubin is found in 2 states ; Direct and Indirect bilirubin. Indirect bilirubin is not conjugated…

Q: Positive thigmotropism is a response in plants in which they move and grow toward an object the…

A: Thigmotropism can be defined as a response to touch;It is basically a curvature movement in which a…

Q: European cuckoos and North American brown-headed cowbirds are not close relatives, but both lay…

A: Animal behavior is heavily influenced by the environment to which it belongs. If they do not fit in,…

Q: What are the best adaptations and modifications of protozoans? Cite specific examples per group. 2.…

A: Protozoa are minute, mostly microscopic animals. Most protozoans are free living in water and some…

Q: PRIMAL PICTURES 1. Name the nervous system receptor labeled A 2. Name the specific structure labeled…

A: The image provided above is an image from the anatomy of the skin. The anatomy of skin shows that…

Q: Choose which does NOT belong to the group then give the commonality of the remaining 3 terms 1.…

A: In plants; each part have different roles to play for the proper development of plants.

Q: Question 30 a co-immunoprecipitation experiment is shown comparing cancer and non- cancer cells,…

A: 30... Western blot Western blot work on enzyme-linked immunosorbent assay principle, The Western…

Q: What information does the Shannon index provide? What different factors should you consider before…

A: The Shannon diversity index calculator is a tool that may be used to estimate species diversity in a…

Q: 1.Compare the structures of ATP to these nucleic acids: cAMP, dinucleotides, RNA, DNA. Your…

A: Nucleic acids include DNA and RNA. The DNA and RNA stand for deoxyribonucleic acid and ribonucleic…

Q: Some substitution mutation result in a malfunctioning protein but others do not. Why is this? 

A: A mutation is a change that occurs while copying or trying to replicate DNA molecules, resulting in…

Q: 3. The data in Table 3.1 are from an investigation of an outbreak of severe abdominal pain,…

A: A frequency distribution is a list, table, or graph in statistics that shows the frequency of…

Q: 1. What is the probability that one of the offspring will have the genotype DdEeFfggHHli? 2. What is…

A:

Q: In the purple-crowned fairy-wren (Malurus coronatus), most subordinate helpers at the nest feed full…

A: The purple-crowned fairywren (Malurus coronatus) is a species of bird in the Maluridae family of…

Q: Renal threshold for glucose is ---- mg/dl

A: In physiology, renal threshold refers to the concentration of a substance dissolved in the blood,…

Q: Whale 100,000 calories 200 kilocalories (kcal) Krill 1,000,000 calories 80 kcal Cellular respiration…

A: The plants and animals produce the organic material which is renewable and it is known as the living…

Q: A survey on the trait: Free and Attached earlobes.The allele for free-hanging earlobes is F.while…

A: We have,  Total number of students - 600 Number of students with attached earlobe (recessive) - 278…

Q: What is the role of centrosomes during cell division? OA. to form the spindle fibers that attach to…

A: ANSWER;-D) to form the connection between two chromosomes Explain;- A centrosome is a cell structure…

Q: The bond is found in protein and linked the amino acid is

A:

Q: If the molecular weight of E.coli DNA is taken as 2.7x10 and the average molecular weight of any…

A: Note: The Values given in the question may be different as in original question, but concept is…

Q: The job of a ribosome is to: make an mRNA transcript of DNA synthesize a new strand of DNA using the…

A: INTRODUCTION Protein synthesis is the process in which the formation of new proteins takes place. In…

Q: The code for a fully functional protein is actually coming from an mRNA transcript that has…

A: The process of synthesis of proteins from mRNA is called as translation while the process of…

Q: What is the mode of inheritance shown in this pedigree? O a. Autosomal dominant O b. Mitochondrial O…

A: This is example of autosomal recessive disease

Q: 3. In excitable cells, depolarization is most closely associated with which of the following events?…

A: INTRODUCTION A neuron is the basic functional structure of the central nervous system. Neurons are…

Q: 2. A nursing mother who has an alcoholic drink secretes alcohol into her milk for two to three hours…

A: Alchohol consumption leads to decrease in hormone production.

Q: Based on the past activities about constructing of phylogenetic trees, how do you distinguish…

A: When the evolution of different organisms or species from a common ancestor is depicted through a…

Q: here is a hypothetical gene related to the nervous system of Drosophila. Describe all the methods,…

A: In situ hybridization (ISH) is a type of hybridization that uses a labeled complementary DNA, RNA or…

Q: 1. Explain the role of Statistics in biological science.

A: Statistics is the science of collecting, analyzing, presenting, and interpreting data.

Q: To summarize: The concept of energy flow through a food web.

A: The Sun provides energy to the Earth in the form of light. The organisms efficiently exploit the…

Q: You are investigating the loss of activity of a particular enzyme in a mutamt bacterium. You…

A: The activity of an enzyme is micromoles of product formed per minute. The enzyme interacts with to…

Q: Answer in 3-5 sentences. What is the difference between thermoregulation in endothermic animals and…

A: Thermoregulation is process by which mammals maintain body temperature with tightly controlled…

Q: Fetuses whose cells are triploid, that is, contain three full sets of chromosomes, develop to term…

A: INTRODUCTION The DNA molecule is packed into thread-like structures called chromosomes in the…

Q: S-phase arrest in response to glutamine deprivation in KRas-driven cancer cells can be reversed by…

A: The shortage of deoxynucleotides required for DNA synthesis causes KRas-driven cancerous cells to…

Q: Mr. Miller has a garden that he uses for his vegetables. There is a contaminant chemical that is a…

A: In given information the body weight is missing.  I'm taking avarage body weight - 70 kg And avarage…

Q: A cephalosporin that may cause a CU Ceftriaxone O a. O b. Cefaclor O c. Cephalexin O d. Cephamycin

A: Cephalosporins are a type of broad-spectrum, chemically synthesized -beta-lactam antibiotics and are…

Q: To test evolutionary hypotheses, you make a phylogeny of a group of organisms based on six traits: -…

A: The phylogenetic tree is given in the question. The phylogenetic tree depicts the relationship…

Q: The needed to raise one gram of water one degree celsius is called a calorie. A. kilocalories B.…

A:

Q: 1 2 10 3 11 12 13 5 14 15 6 8 16 Figure 8.1 Muscles in the dorsal side of the frog

A: Soft tissues include muscles. Your muscles are made up of many flexible fibres.

Q: Describe the function of the key Agrobacterium proteins involved in the transfer and integration of…

A:

Q: Dekaylen umber of human diseases result from chromosomal abnormalities. Individuals with cri du chat…

A: Cri-du-chat syndrome, often called 5p- (five p minus) syndrome, is a chromosomal disorder caused by…

Q: If a phage is undergoing lytic growth, which protein is bound to the operator region? O Both Lambda…

A: INTRODUCTION Lytic stage of phage This is the reproductive stage of bacteriophage  it include 6…

Q: Based on the fish dissection, describe the structure of skull and vertebral column design. How does…

A: Answer

Q: Glycogenolysis is considered to be which of the following? Group of answer choices an example of…

A: Metabolism is a phenomenon takes place inside the body of an organism in which material are either…

Intelligence

Intelligence refers to the intellectual functioning that compares a person's intelligence quotient (IQ) with other people of the same age. In other words, it is the ability to understand circumstances or situations and arrive at appropriate solutions. Both animals and plants exhibit intelligence.