Using bacteria that express double stranded RNA upon induction by IPTG, investigators have constructed an RNAi library that allows you to feed C. elegans bacteria that expresses dsRNA corresponding to a given gene to obtain progeny that have been compromised for this target mRNA. This was performed for every predicted gene in the animal. From this experiment, 1200 genes of the 19000 predicted genes tested caused sterility in adult animals. 200 of the 1200 candidates that cased sterility were of unknown function. Q4a) What can we conclude from this information? Q4b) What processes are the genes with unknown function likely involved in?

Using bacteria that express double stranded RNA upon induction by IPTG, investigators have constructed an RNAi library that allows you to feed C. elegans bacteria that expresses dsRNA corresponding to a given gene to obtain progeny that have been compromised for this target mRNA. This was performed for every predicted gene in the animal. From this experiment, 1200 genes of the 19000 predicted genes tested caused sterility in adult animals. 200 of the 1200 candidates that cased sterility were of unknown function. Q4a) What can we conclude from this information? Q4b) What processes are the genes with unknown function likely involved in?

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter10: Biotechnology

Section: Chapter Questions

Problem 4DID

See similar textbooks

Similar questions

A mutant strain of Salmonella bacteria carries a mutation of the rho protein that has fully activity at 37°C but is completely inactivated when the mutant strain is grown at 40°C. a)Speculate about the kind of differences you would expect to see if you compared a broad spectrum of mRNAs from the mutant strain grown at 37°C and the same spectrum of mRNAs from the strain when grown at 40°C. b)Are all the mRNAs affected by the rho protein mutation in the same way? Why or why not?
A graduate student studying the pathogenic bacteria Acinetobacter baumannii made cDNA from planktonic cells and biofilm cells and performed RNA-Seq on both samples. She aligned her sequencing reads to a locus of the baumannii genome as shown. a. Which genes are on an operon together? Explain which data supports this? b. What is the most expressed transcript from the locus in Planktonic culture? c. Order the transcripts from largest increase in relative expression between biofilm and planktonic cells to the largest decrease in relative expression. d. When this data was compared to microarray transcriptional profiling, the microarray data provided lower expression levels for the most highly expressed transcripts. Why did this occur?
A graduate student studying yfgA expression in the liver and heart performs an RNA-seq experiment. She aligns her sequencing reads to the human genome as shown. a.) What splice variants are expressed in the liver? Draw the mRNA and label the exons.b.) Are they expressed at the same levels in the liver? Explain c.) What splice variants are expressed in the heart. Clearly explain all the data from the figure. d.) In which tissue is the gene more highly expressed? Explain
The ability to selectively modify the genome in the mouse has revolutionized mouse genetics. Outline the procedure for generating a knockout mouse at a specific genetic locus. How can the loxP-Cre system be used to conditionally knock out a gene? What is an important medical application of knockout mice?
In the bacteriophage T7 system used to express recombinant proteins, the gene of interest is fused to T7 promoter and T7 RNA polymerase is separately cloned into the same cell. What is the main reason this system uses T7 RNA polymerase instead of relying on the bacterial RNA polymerase? To restrict the expression of bacterial protein expression To enhance the amount of recombinant protein expression To enhance the expression of bacterial protein expression To restrict the amount of recombinant protein expression To enable the expression of T7 viral protein expression
An enhancer, located upstream from a gene, has the following sequence: 5′–GTAG–3′ 3′–CATC–5′ This enhancer is orientation-independent. Which of the following sequences also works as an enhancer? A. 5′–CTAC–3′ 3′–GATG–5′ B. 5′–GATG–3′ 3′–CTAC–5′ C. 5′–CATC–3′ 3′–GTAG–5′ C15.
APOE gene has been found to be a major contributor to sporadic Alzheimer's disease (AD), by acting as an age-of-onset modifier for the common relatively late-onset forms of the disease. Among four alleles causing early onset of AD, the epsilon4 allele (APOE4) disrupts this function. If you generate transgenic monkeys in which the normal allele of APOE gene is knocked out, what phenotype will you expect for those knockout monkeys? A. The APE mRNA expression will be completely suppressed. B. They slow down the development of AD. C. They develop AD early. D. They don't show any AD symptom.
You then make a screen to identify potential mutants (shown as * in the diagram) that are able to constitutively activate Up Late operon in the absence of Red Bull and those that are not able to facilitate E. Coli growth even when fed Red Bull. You find that each class of mutations localize separately to two separate regions. For those mutations that prevent growth even when fed Red Bull are all clustered upstream of the core promoter around -50 bp. For those mutations that are able to constitutively activate the operon in the absence of Red Bull are all located between the coding region of sleep and wings. Further analysis of each DNA sequence shows that the sequence upstream of the promoter binds the protein wings and the region between the coding sequence of sleep and wings binds the protein sleep. When the DNA sequence of each is mutated, the ability to bind DNA is lost. Propose a final method of gene regulation of the Up Lateoperon using an updated drawn figure of the Up Late…
lin-28 is a gene that is critical for stem cell integrity in mammals and is involved in tumourigenesis, but it was originally identified as a gene involved in developmental timing in C. elegans. It is targeted by the microRNAs lin-4 and let-7 and this affects its translation. Q2a) If the lin-4 sequence is 5’-UCCCUGAGACCUCAAG-3’, which of the following sequences might best correspond to the single target RNA sequence in the 3’UTR of lin-28. A) 3’ UTR- 5’-UCCCUGAGACCUCAAG-3’ B) 3’ UTR- 5’-CUUGAAAUCUCAGUUA-3’ C) 3’ UTR- 5’-CUUGAGGUCUCAGGGA-3’ Q2b) Then describe in 2 sentences/lines why you chose this target sequence.
a. Some antibiotics, such as rifampin, interfere with the function of RNA polymerase. What biological process is rifampin disrupting? b. Some antibiotic-resistant M. tuberculosis bacteria have a single point mutation (CàT) in the rpoB gene that causes an amino acid change from serine (a polar amino acid) to leucine (a non-polar amino acid). What type of mutation is this? Do you expect this to have no effect, a small effect, or a large effect on the polypeptide produced? Explain your reasoning. c. The rpoB gene encodes a subunit of the bacterial RNA polymerase protein. The point mutation described in Question 2 causes a change in protein folding, which leads to the inability of the rifampin antibiotic to bind to the RNA polymerase. Which level(s) of protein structure is/are affected by this change?
You are studying a rare form of brain cancer where the newly-discovered genes BR and AIN are known to play a role in the development of this cancer. You perform a RNA-seq analysis on a patient with this form of cancer and compare the resulting expression histogram to a healthy patient. You conclude that AIN is heavily upregulated in the cancer patient and that the cancer patient's mRNA for BR retains one of that gene's introns in the RNA-seq results. Based on this information, BR is likely a(n) _________ and AIN is likely a(n) _________ . a. oncogene; tumor-suppressor gene b. tumor-suppressor gene; tumor-suppressor gene c. oncogene; oncogene d. tumor-suppressor gene; viral gene e. tumor-suppressor gene; oncogene
By whole-exome sequencing, you have identified an early termination mutation in KLHL4 in a human patient with an undiagnosed blood vessel anomaly. There is almost nothing known about the function of this gene, and no existing animal models! To begin to understand its function, you decide to use the zebrafish model. You first want to know where in the embryo this gene is expressed. Which technique would you use to identify the cell type that expresses klhl4 mRNA in zebrafish embryos? You find that this gene is expressed in endothelial cells, which line blood vessels. Intrigued by this finding, you next decide to disrupt the gene in zebrafish using CRISPR/Cas9. The DNA sequence that you want to target is below. What is the sequence of your 20-base guide RNA? 5’ TAGCAATTATGCGCGCTAGCAATTGCGTAGGTCATAATGCAGCTGAC 3’ 3’ ATCGTTAATACGCGCGATCGTTAACGCATCCAGTATTACGTCGACTG 5’ After injecting the gRNA with Cas9, what are potential outcomes? Enter true or false.…