You then make a screen to identify potential mutants (shown as * in the diagram) that are able to constitutively activate Up Late operon in the absence of Red Bull and those that are not able to facilitate E. Coli growth even when fed Red Bull. You find that each class of mutations localize separately to two separate regions. For those mutations that prevent growth even when fed Red Bull are all clustered upstream of the core promoter around -50 bp. For those mutations that are able to constitutively activate the operon in the absence of Red Bull are all located between the coding region of sleep and wings. Further analysis of each DNA sequence shows that the sequence upstream of the promoter binds the protein wings and the region between the coding sequence of sleep and wings binds the protein sleep. When the DNA sequence of each is mutated, the ability to bind DNA is lost. Propose a final method of gene regulation of the Up Lateoperon using an updated drawn figure of the Up Late operon. Explain in detail. You are studying a new operon that you have discovered in E. Coli that you have named the UpLate operon for its ability to help E. Coli grow and divide by feeding it Red Bull. You havediscovered three genes (sleep, wings, and energy) encoded within the polycistronic templatemade from the operon. The transcription start site is indicated at the arrow and the proteinencoding sequences are encoded by the boxes with the names of the genes inside, with a blowup of the nucleotide sequence at the promoter, with the transcription start occurring at the C.(Asterisks for part F)sleepwingsenergy5'-TGTTGAСАСАТСАGGCТAGCATTАTААAGCCGGCTAGCTAGCATGCAAAGCCTАCGTT-3'3'-АСААСТGTGTAGTCCGATCGTAATATTТCGGCCGAТCGATCGTACGTTTCGGATGCAA-5' F. You then make a screen to identify potential mutants (shown as in the diagram) thatare abie to consitulively activate Up Late operan in the absence of Red Bui and thosethat are not able to facilitate E. Coli growth even when fed Red Bull. You find that eachdass of mutations localize separately to two separate regions. For those mutations thatprevent growth even when fed Red Bul are all dustered upstream of the core promoteraround -50 bp. For those mutations that are able to constitutively activate the operon inthe absence of Red Bull are all located between the coding region of sieep and wings.Further analysis of each DNA sequence shows that the sequence upstream of thepromoter binds the protein wings and the region between the coding sequence of sieepand wings binds the protein sloep. When the DNA soquence of each is mutated, theability to bind DNA is lost. Propose a final method of gene regulation of the Up Lateoperon using an updated drawn figure of the Up Late operon.

An operon is a part of the DNA where a few genes are clustered together that are transcribed…

Answered: Propose a final method of gene…

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter14: Gene Regulation

Section: Chapter Questions

Problem 11TYU

See similar textbooks

Related questions

Concept explainers

Question

You then make a screen to identify potential mutants (shown as * in the diagram) that are able to constitutively activate Up Late operon in the absence of Red Bull and those that are not able to facilitate E. Coli growth even when fed Red Bull. You find that each class of mutations localize separately to two separate regions. For those mutations that
prevent growth even when fed Red Bull are all clustered upstream of the core promoter around -50 bp. For those mutations that are able to constitutively activate the operon in the absence of Red Bull are all located between the coding region of sleep and wings. Further analysis of each DNA sequence shows that the sequence upstream of the promoter binds the protein wings and the region between the coding sequence of sleep
and wings binds the protein sleep. When the DNA sequence of each is mutated, the ability to bind DNA is lost. Propose a final method of gene regulation of the Up Lateoperon using an updated drawn figure of the Up Late operon. Explain in detail.

You are studying a new operon that you have discovered in E. Coli that you have named the Up
Late operon for its ability to help E. Coli grow and divide by feeding it Red Bull. You have
discovered three genes (sleep, wings, and energy) encoded within the polycistronic template
made from the operon. The transcription start site is indicated at the arrow and the protein
encoding sequences are encoded by the boxes with the names of the genes inside, with a blow
up of the nucleotide sequence at the promoter, with the transcription start occurring at the C.
(Asterisks for part F)
sleep
wings
energy
5'-TGTTGAСАСАТСАGGCТAGCATTАTААAGCCGGCTAGCTAGCATGCAAAGCCTАCGTT-3'
3'-АСААСТGTGTAGTCCGATCGTAATATTТCGGCCGAТCGATCGTACGTTTCGGATGCAA-5'

F. You then make a screen to identify potential mutants (shown as in the diagram) that
are abie to consitulively activate Up Late operan in the absence of Red Bui and those
that are not able to facilitate E. Coli growth even when fed Red Bull. You find that each
dass of mutations localize separately to two separate regions. For those mutations that
prevent growth even when fed Red Bul are all dustered upstream of the core promoter
around -50 bp. For those mutations that are able to constitutively activate the operon in
the absence of Red Bull are all located between the coding region of sieep and wings.
Further analysis of each DNA sequence shows that the sequence upstream of the
promoter binds the protein wings and the region between the coding sequence of sieep
and wings binds the protein sloep. When the DNA soquence of each is mutated, the
ability to bind DNA is lost. Propose a final method of gene regulation of the Up Late
operon using an updated drawn figure of the Up Late operon.

Expert Solution

Trending now

This is a popular solution!

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.