Using the Concord Consortium interactive, observe how mutations can affect protein formation and function. From your observations of the interactive, summarize your observations of how each change in DNA affects the protein that is made. Screenshots will be required for your assignment. Interpret and analyse your results: identify the type of mutation, and describe and explain the effect of each change on protein size, shape and polarity.

Using the Concord Consortium interactive, observe how mutations can affect protein formation and function. From your observations of the interactive, summarize your observations of how each change in DNA affects the protein that is made. Screenshots will be required for your assignment. Interpret and analyse your results: identify the type of mutation, and describe and explain the effect of each change on protein size, shape and polarity.

Name: InstructionsUsing the Concord Consortium interactive, observe how mut
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: InstructionsUsing the Concord Consortium interactive, observe how mutations can affect proteinformation and function. From your observations of the interactive, summarize yourobservations of how each change in DNA affects the protein that is made.Sc

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter14: Biotechnology And Society

Section: Chapter Questions

Problem 7QP

See similar textbooks

Similar questions

Please help witht this homework question A- What are the topological parameters (linking number, twist, and writhe)for a relaxed, 4,200 base pair circular double-stranded DNA plasmid? LK=? Tw= ? Wr=? The CRISPR-Cas9 protein first forms a protein-RNA complex with a guide RNA, and then binds to DNA sequences that match a 20-base target sequence within the guide. When the CRISPR-Cas9 complex binds to DNA, it unwinds about 20 base pairs of the DNA double helix. B- Why is DNA unwinding required for CRISPR-Cas9 protein-RNA complexto recognize target sites? C-How would the topological parameters (linking number, twist, andwrithe) of the 4,200 bp plasmid in (A) change when the CRISPR-Cas9 complex binds the DNA and unwinds about 20 bp? Lk=? Tw=? Wr=? D- What is the linking number after the CRISPR-Cas9 complex cleaves theDNA?
Q-)Silent mutations that occur in DNA are quite common in living cells and usually involve no effects onphenotype. In not more than 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provideanswers for the following questions? A) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect onthe phenotype and provide a brief description of its molecular characteristics?
Topic: Recombinant pharmaceuticals (for the production of insulin, human growth hormone or blood clotting factors) Question What are the drawbacks/disadvantages/unknowns associated with this genetic process?
Question:- Can you please explain the general rule on how to manually align these sequence?? i am very confused when you have to use a dash '-'. I have never been taught how to sequence so this to me is new and confusing i dont know what i am doing. any advice/tips would be great. please explain step by step as to why you added the dash so i can understand and learn. thank you so much Align the following sequences Sequence A: CUCGAGUUAACCCGGCACCCG Sequence B: GCUCGGGUUAACACGGACCCG Sequence C: UCGAGCCAACUCGGACCCG
Instruction - Please answer them correctly - Please answer all of them, they are connected. MUTATION Fill in the correct nucleotide base pairing and amino acid sequence of the mutated DNA a. What is the 3’-5’ DNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) b. What is the mRNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) c. What is the tRNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) d. What is the amino acid sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) e. What is the most convincing type of mutation had occurred? (Frameshift resulting Missense; Frameshift resulting Nonsense; Substitution – Silent; Substitution – Missense; Substitution – Nonsense)
HELP PLEASE !! You are looking at a region of the genome that codes for a gene involved in enamel syntheiss. You do not have a transcripome (RNA sequence). Outline a protocol for deducing the ORF and the protein sequence.
Topic: Recombinant pharmaceuticals (for the production of insulin, human growth hormone or blood clotting factors) Question When or why is this genetic technology/process used? Who benefits from this genetic technology/process - and how?
Reflect on this “Gene therapy is still in its infancy but it is believed that as it matures it will become an effective treatment for the myriad of genetic diseases that affect humanity”
HELP PLEASE !! In moelcular genetics, initiation is often accomplished using proteins that prevent elongation. Name and describe 3 processes where this happens, they can be in different species. Make sure to name or describe the proteins and substrates involved and how the elongation inhibition is overcome.
Please answer fast We have lots of options when it comes to trying to purposefully make mutations while doing research. Please brieflyname/describe a method you could use to make: a) random mutations anywhere within the genome in living cells (in vivo) b) random mutations within our cloned gene of interest in vitro c) a very specific (non-random) mutation within our cloned gene of interest in vitro d) NOW for the answer you gave in part C, please elaborate in detail how this method of mutagenesis is performed.
how do i expand this into 1000 words The methodology employed to identify differentially expressed genes (DEGs) in breast cancer using RNA-Seq data involves several systematic steps integrating data retrieval, analysis, normalization, DEG identification, and functional annotation. Initially, raw RNA-Seq data is retrieved from the NCBI GEO database, specifically from dataset GSE216238 (Nakshatri, 2023), which encompasses samples from both breast cancer and normal tissue. Subsequently, the raw data was imported into Excel for initial analysis, leveraging its widespread availability and user-friendly interface. Gene expression data for breast cancer analysis was obtained from the Gene Expression Omnibus (GEO) database. The GEO homepage (https://www.ncbi.nlm.nih.gov/geo/) was accessed, and the "Query & Browse" tab was selected. Advanced Search: Under "Search GEO DataSets," an advanced search was conducted (https://www.ncbi.nlm.nih.gov/gds/advanced). Keywords "breast" and "cancer" were…
BLAST searches and related applications are essential for analyzinggene and protein sequences. Define BLAST, describe basic features of this bioinformatics tool, and give an example of informationprovided by a BLAST search