Using the figure below briefly explain how recombinant lentiviral particle can be formed. Recombinantlentiviral particleViral membraneNucleocapsid-VSV G proteinRetroviral RNAGene forClonedVSV G proteingeneneorPromoterLTRViralLTRPackagingplasmidVectorViral coatorigin ofreplicationplasmidplasmidLodish et al., Molecular Cell Biology, 9e, © 2021 W. H. Freeman and Company

The figure shows a diagram in which there is a recombinant lentiviral particle that is composed of…

Answered: Using the figure below briefly explain…

Science

Biology

Using the figure below briefly explain how recombinant lentiviral particle can be formed.

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 9P: Heteroduplex DNA Formation in Recombination From the information in Figures 28.17 and 28.18, diagram...

See similar textbooks

Related questions

Q: Embryonated eggs are widely used for viral cultivation. Explain

A: Prior to the development of cell culture, most of viruses were propagated using embryonated eggs.…

Q: Can you give me an example situation of triangulation?

A: Triangulation is the process where two-person do not directly communicate with each other instead…

Q: Describe five distinct methods to distinguish different strains.

A: The strain of a microbe is defined as its subtype or genetic variant. In viruses, the strains…

Q: Discuss the recombinant DNA techniques that could be used to develop detection systems for the…

A: Deoxyribonucleic acid (DNA) is a molecule made up of two polynucleotide chains that coil around each…

Q: Is mother plant and stock plant same? How meristem culture produce virus free plants

A: Mother plant have the ability to grow more and more plant for the purpose of taking cuttings. The…

Q: What would be a disadvantage of reproducing using a spore?

A: Reproduction can be asexual and also sexual. Spore formation is an asexual form of reproduction in…

Q: Draw and illustrate how latex agglutination works to bind to ASO and form agglutinates

A: Agglutination Test -- Tests are regarded as screening tests .There are many tests based on the…

Q: Give one difference between a hybrid and a somatic hybrid.

A: A somatic hybrid is made from somatic cells whereas a hybrid is the result of fusion of gametes.…

Q: Mention any three vector-less methods that are used to introduce recombinant DNA into a competent…

A: Micropropagation ,electroporation and gene gun methods are three vectorless methods that are used to…

Q: How can recombination cause gene duplication  describe one example of a how a gene duplication…

A: So firstly we are going to learn what is Gene duplication and how it can occur due to formation of…

Q: Give method of breeding for disease resistence?

A: Plant breeding is a method of introducing favorable genes into the desired species. The favorable…

Q: What does the following vector produce? Be specific.

A: Vector is defined as a DNA molecule that is used as a vehicle to carry foreign genetic material into…

Q: Match the photo to the name of the vector

A: A vector is a living organism that transmits an infectious agent from an infected animal to another…

Q: In the image below, what is the C label pointing to?

A: In this figure, RNA polymerase move along the DNA to the right and spool out mRNA and this process…

Q: Which part of the plant is best suited for making virus-free plants and why?

A: A virus is a very small submicroscopic agent that is known for causing infections in its host…

Q: how a RT-PCR test could be set up for the detection of this virus

A: Polymerase chain reaction (PCR) is a tool in molecular biology. This tool is used to amplify the…

Q: what is an alternative method of solving the covid-19 disease from spreading from one person to…

A: Covid-19 is a respiratory system-based illness caused by a coronavirus. This virus has a very high…

Q: Explain how In situ hybridization can detect activity of specific genes in whole and sectioned…

A: Introduction In situ hybridization (ISH) is a form of hybridization that uses a labeled…

Q: Explain the purpose of a testcross.

A: A test cross is a method for investigating the genotype of a parent organism. Early utilization of…

Q: Explain how the analysis of arginine auxotrophs implied that a single gene corresponds to a single…

A: The genes are the components of the genome that direct specific functions in the cell. Their…

Q: What practical applications could be made with male sterile lines of maize?

A: Plants that are devoid of functional pollen grains carrying male gametes are known as male sterile…

Q: In addition to the use of T-DNA vectors, other methods toproducetransgenic plants includea.…

A: Transgenic plants are plants that have been genetically engineered. It is a breeding approach that…

Q: Differentiate between parental and recombinantgametes

A: Gametes are the haploid germ cells that unite with the another gamete of the opposite sex during…

Q: Briefly describe the grafting process.

A: Grafting is the process of joining two plants together to grow as one. The upper portion of the…

Q: Write a simple and short methodology on how to isolate ovalbumin from an egg white.

A: Egg white: a. Egg white consists largely of water (90%) and protein makes up only 10%. b. The…

Q: Based on your knowledge of genetics, how would you determine whether kanamycin or BASTA-resistant T2…

A: Kanamycin A, often known as kanamycin, is an antibiotic used to treat tuberculosis and severe…

Q: Using a flow diagram, elaborate on how you would generate a recombinant plasmid.

A: Plasmid is a circular double stranded DNA molecule found in bacteria and is capable of self…

Q: . The short length of STRs allows them to be replicated by ___________.

A: The human genome possesses numerous small noncoding but inheritable sequences of bases that are…

Q: Discuss how genetic mosaics can help determine thefocus of action of a gene.

A: Mosaic in genetics is the phenomenon in which in an individual two or more different types of cells…

Q: Explain briefly about The Case of Genetically Modified Tomato Paste

A: A plants whose the DNA has been modified using genetic engineering method are known as genetically…

Q: Explain how you would prepare serial dilations of 10-2,10-4,10-5 of a milk sample in three steps

A: Serial dilution is a lab procedure used in microbiology to estimate the concentration or number of…

Q: Transmission studies suggest that there are at least three (3) different variants of the SARS-CoV-2…

A: SARS-CoV2 is a virus consisting of four main structural proteins called spike, membrane, envelop,…

Q: Describe the process of Southern blotting.

A: Introduction: Southern blotting works on the principle involving the separation of fragments of DNA…

Q: Can you think and answer how a reporter enzyme can be used to monitor transformation of host cells…

A: An example of a reporter gene is the Lac Z gene, this gene encodes for fluorescent proteins in the…

Q: . Give an example of a DNA-repair defect that leads tocancer

A: Cancer results when body mechanism fails to control the cell division that has lost the control…

Q: Illustrate how latex agglutination works to bind to ASO and form agglutinates

A: Answer: Introduction: The assessment of latex agglutination rest on what kind of sample is required.…

Q: Enlist the step of controlled cross polination?

A: The pollen deposition from a flower’s male part to the female part of another flower is called…

Q: Describe sectored colonies in yeast and theirsignificance in evaluating mitotic recombination.

A: Mitosis is the process where chromosomes divide to produce two identical nuclei before being packed…

Q: What would be an advantage of reproducing using a spore ?

A: Advantages of reproducing using a spore : Spores can remain dormant till favourable conditions…

Q: What is the best way to explain progeria on a DNA/chromosome level

A: Answer: PROGERIA : It is basically a rare chromosomal disorder in children. this syndrome can be…

Q: Consider and interpret the results of agarose gel electrophoresis and spectrophotometer for the…

A: Answer. Electrophoresis of nucleic acids: Gel electrophoresis is the process by which scientists can…

Q: Antirrhinum can have pink RB, white BB, or red RR flowers. Give the phenotypic and genotypic ratios…

A: The complete set of the genetic material of a particular organism is referred to as genotype. The…

Q: What is a recombinant DNA vaccine?Give two examples.

A: Vaccines are either attenuated or dead agents of disease which when administered into a healthy…

Q: Give reasons why you do not need to worry about the COVID vaccines altering your DNA. Explain

A: Coronavirus disease (COVID-19) is an infectious disease, a pandemic of respiratory illness caused by…

Q: It is posible to transfer physical traits without the presence of chromosomes?

A: Genes are contained in chromosomes, which are in turn present in the cell nucleus. A chromosome has…

Q: Can you suggest a method to remove oil (hydrocarbon) from seeds based on your understanding of 1DNA…

A: Introduction We will answer the question in below step.

Q: Describe step 5 of recombination: Branch migration

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: The genetically inherited disease shown in the picture above is:

A: this is comes from genetics

Q: describe Complementation testing using F' plasmids

A: F’ plasmid is a variant of F-plasmid which are involved in conjugation between bacteria. Conjugation…

Concept explainers

Genetic Recombination

Recombination is crucial to this process because it allows genes to be reassorted into diverse combinations. Genetic recombination is the process of combining genetic components from two different origins into a single unit. In prokaryotes, genetic recombination takes place by the unilateral transfer of deoxyribonucleic acid. It includes transduction, transformation, and conjugation. The genetic exchange occurring between homologous deoxyribonucleic acid sequences (DNA) from two different sources is termed general recombination. For this to happen, an identical sequence of the two recombining molecules is required. The process of genetic exchange which occurs in eukaryotes during sexual reproduction such as meiosis is an example of this type of genetic recombination.

Microbial Genetics

Genes are the functional units of heredity. They transfer characteristic information from parents to the offspring.

Question

Using the figure below briefly explain how recombinant lentiviral particle can be formed.

Recombinant
lentiviral particle
Viral membrane
Nucleocapsid-
VSV G protein
Retroviral RNA
Gene for
Cloned
VSV G protein
gene
neor
Promoter
LTR
Viral
LTR
Packaging
plasmid
Vector
Viral coat
origin of
replication
plasmid
plasmid
Lodish et al., Molecular Cell Biology, 9e, © 2021 W. H. Freeman and Company

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

To determine the reproducibility of mutation fre-quency measurements, you do the following experiment.You inoculate each of 10 cultures with a single E. coli bac-terium, allow the cultures to grow until each contains 106cells, and then measure the number of cells in each culturethat carry a mutation in your gene of interest. You were sosurprised by the initial results that you repeated the experi-ment to confirm them. Both sets of results display the sameextreme variability, as shown in Table Q5–1. Assuming thatthe rate of mutation is constant, why do you suppose thereis so much variation in the frequencies of mutant cells indifferent cultures?
A number of yeast-derived elements were added to thecircular bacterial plasmid pBR322. Yeast that requireuracil for growth (Ura− cells) were transformed withthese modified plasmids and Ura+ colonies were selected by growth in media lacking uracil. For plasmidscontaining each of the elements listed in parts (a) to(c), indicate whether you expect the plasmid to integrate into a chromosome by recombination, or insteadwhether it is maintained separately as a plasmid. If theplasmid is maintained autonomously, is it stably inherited by all of the daughter cells of subsequent generations when you no longer select for Ura+ cells (that is,when you grow the yeast in media containing uracil)?a. URA+ geneb. URA+ gene, ARS c. URA+ gene, ARS, CEN (centromere)d. What would need to be added in order for these sequences to be maintained stably in yeast cells as alinear artificial chromosome?
The terms conjugation, transduction, and transformation are usedto describe three different natural forms of genetic transferbetween bacterial cells. Briefly discuss the similarities and differencesamong these processes?
Please ASAP. Thank you. What is the mechanism of action for CRE recombinase in the CRE-loxP system?
Price et al. [(1999). J. Bacteriol. 181:2358–2362] conducteda genetic study of the toxin transport protein (PA) of Bacillusanthracis, the bacterium that causes anthrax in humans. Withinthe 2294-nucleotide gene in 26 strains they identified five pointmutations—two missense and three synonyms—among differentisolates. Necropsy samples from an anthrax outbreak in 1979revealed a novel missense mutation and five unique nucleotidechanges among ten victims. The authors concluded that thesedata indicate little or no horizontal transfer between differentB. anthracis strains. Question: Which types of nucleotide changes (missense or synonyms)cause amino acid changes?
Price et al. [(1999). J. Bacteriol. 181:2358–2362] conducteda genetic study of the toxin transport protein (PA) of Bacillusanthracis, the bacterium that causes anthrax in humans. Withinthe 2294-nucleotide gene in 26 strains they identified five pointmutations—two missense and three synonyms—among differentisolates. Necropsy samples from an anthrax outbreak in 1979revealed a novel missense mutation and five unique nucleotidechanges among ten victims. The authors concluded that thesedata indicate little or no horizontal transfer between differentB. anthracis strains. Question: On what basis did the authors conclude that evidence ofhorizontal transfer is absent from their data?
Price et al. [(1999). J. Bacteriol. 181:2358–2362] conducteda genetic study of the toxin transport protein (PA) of Bacillusanthracis, the bacterium that causes anthrax in humans. Withinthe 2294-nucleotide gene in 26 strains they identified five pointmutations—two missense and three synonyms—among differentisolates. Necropsy samples from an anthrax outbreak in 1979revealed a novel missense mutation and five unique nucleotidechanges among ten victims. The authors concluded that thesedata indicate little or no horizontal transfer between differentB. anthracis strains. Question: What is meant by ”horizontal transfer”?
The human RefSeq of the entire first exon of a geneinvolved in Brugada syndrome (a cardiac disordercharacterized by an abnormal electrocardiogram andan increased risk of sudden heart failure) is:5′ CAACGCTTAGGATGTGCGGAGCCT 3′The genomic DNA of four people (1–4), three ofwhom have the disorder, was subjected to singlemolecule sequencing. The following sequences represent all those obtained from each person. Nucleotidesdifferent from the RefSeq are underlined. Individual 1:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGCGGAGACT 3′Individual 2:5′ CAACGCTTAGGATGTGAGGAGCCT 3′Individual 3:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGGCGGAGCCT 3′Individual 4:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGTGGAGCCT 3′a. The first exon of the RefSeq copy of this gene includes the start codon. Write as much of the aminoacid sequence of the encoded protein as possible,indicating the N-to-C polarity.b. Are any of these individuals homozygotes? If so,which person and what allele?c. Is…
#2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
1a.The complete genotype of the host yeast strain is MATa ade2 his3 leu2 met15 ura3. Name one advantage of using a yeast strain with auxotrophies for several genes (i.e. his3, leu2 and ura3). b.)After successful CRIPSR editing, the yeast can later be “cured” of the recombinant CRISPR plasmid – that is, the plasmid is lost but the CRISPR edit is stably inherited. Write the new genotype of the yeast based on ADE6 gene.
You are cloning the genome of a new DNA virus into pUC18.You plate out your transformants on ampicillin plates containing X-gal and pick one blue colony and one white colony.When you check the size of the inserts in each plasmid (blueand white), you are surprised to fi nd that the plasmid fromthe blue colony contains a very small insert of approximately60 bp, while the plasmid from the white colony does notappear to contain any insert at all. Explain these results.
#4 BamI --- 5’ CCTAG ↓G 3’ 5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’ 3’ TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut: