Using the figure below, which end of the double helix,"A" or "B", would be considered the 5 prime end? B (type "A" or "B" in the blank) Which of the following statements would best explain your reasoning for question 1? 1 (type 1, 2 or 3 in the blank) The end of the DNA strand with the phosphate exposed is the 5 prime end The end of the DNA strand that shows the five carbon sugar pointing down is the 5 prime end The end of the DNA strand with the fifth carbon on the sugar molecule is the 5 prime end

Using the figure below, which end of the double helix,"A" or "B", would be considered the 5 prime end? B (type "A" or "B" in the blank) Which of the following statements would best explain your reasoning for question 1? 1 (type 1, 2 or 3 in the blank) The end of the DNA strand with the phosphate exposed is the 5 prime end The end of the DNA strand that shows the five carbon sugar pointing down is the 5 prime end The end of the DNA strand with the fifth carbon on the sugar molecule is the 5 prime end

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter6: Dna Structure And Function

Section: Chapter Questions

Problem 2DID

See similar textbooks

Similar questions

– Draw a DNA strand with 10 adenine bases followed by 10 cytosine bases. If that same strand bonded to a strand of 15 thymine bases and 5 guanine bases, how would the double helix shape vary from a typical DNA double helix? Explain why. Must draw picture of both strands that helps to illustrate your written answer – no credit for one without the other.
What does it mean when we say that the two DNA strands in thedouble helix are antiparallel? What would an end of the double helixlook like if the strands were parallel?
The two strands of a DNA double helix can be separated by heating. if you raised the temperature of a solution containing the following three DNA molecules, in what order do you suppose they would “melt”? explain your answer.A. 5’-GCGGGCCAGCCCGAGTGGGTAGCCCAGG-3’ 3’-CGCCCGGTCGGGCTCACCCATCGGGTCC-5’ B. 5’-ATTATAAAATATTTAGATACTATATTTACAA-3’ 3’-TAATATTTTATAAATCTATGATATAAATGTT-5’C. 5’-AGAGCTAGATCGAT-3’ 3’-TCTCGATCTAGCTA-5’
The following diagram of a generalized tetranucleotide will serve as a basis for the three questions marked “a” through “c.” (02) (a) Is this a DNA or an RNA molecule? State which _________ (b) Place an “X” (in one of the circles provided) at the 3' end of this tetranucleotide. (c) Given that the DNA strand, which served as a template for the synthesis of this tetranucleotide, was composed of the bases 5'- A C A G - 3', fill in the parentheses (in the diagram) with the expected bases
The two strands for the helix-shaped DNA molecule are heldtogether by electrostatic forces as shown in class. Due to electron sharing, themagnitude of the net average charge on the H and N atoms, each, is 0.2e. Thenet average charge on the C and O atoms, each, is 0.4e. The distance betweenany two adjacent atoms on the same molecule is 0.1nm. Since electric fieldsdecrease as an inverse square law, they die off quickly with distance. So, theonly fields that really contribute to any given bond are due to the 3 atomsalong the red dotted line in the class diagram (two atoms on one'molecule andone atom on the other molecule).Calculate the electric fields and net force between a thymineand an adenine pair.=Calculate the electric fields and net force between a cytosineand a guanine pair.nConsider the OHN bond in the AT nucleotide. Can theelectric field be zero anywhere along the axis of this bond? If not,explain why not. If so, find where the electric field is zero.
For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the complementary DNA strand
The nucleotide sequence of one DNA strand of a DNA double helix is 5’-GGATTTTTGTCCACAATCA-3’.What is the sequence of the complementary strand?
The two strands of a DNA double helix can be separated by heating. If you raise the temperature of a solution containing the three DNA molecules below, in what order do you think these DNAs will "melt"? Explain 1)5’-GCGGGCCAGCCCGAGTGGGTAGCCCAGG-3’ 3’-CGCCCGGTCGGGCTCACCCATCGGGTCC-5’ 2) 5’-ATTATAAAATATTTAGATACTATATTTACAA-3’ 3’-TAATATTTTATAAATCTATGATATAAATGTT-5’ 3) 5’-AGAGCTAGATCGAT-3’ 3’-TCTCGATCTAGCTA-5’
5.1) Do you expect DNA strands 1 and 2 below to have the same melting point? Justify your answer. Strand 1: 5′ATTATTTTAAATTTAGCGC3′ Strand 2:5′AAAAAATTTTTTTTTCCGG3′ 5.2) A newly discovered blob protein folds very rapidly in the presence of protein disulphide isomerase and peptidyl prolyl cis-trans isomerase enzymes but aggregates and never folds correctly without protein disulphide isomerase. Explain why this might occur.
Given the following DNA sequence: 5’-ATGCGGCCAAGGTCAGAGTGACA-3’ a) If this DNA strand represents the “Sense Strand” of DNA, what would be the RNA sequence? b) If this DNA strand represents the “Antisense Strand” of DNA, what would be the RNA Sequence? c) What would be the other strand of DNA?
In proteins, a peptide read from the N terminal to the C terminal. Is there a kind of direction in DNA/RNA as well? Briefly explain. What does Chargaff’s rules mean? Who proposed DNA was a double helix? In what decade? If one DNA single strand has the sequence 5’-AATGCAA-3’, what is the sequence of its complementary strand? When DNA replicates, how is it able to “unwind” its double helix?
The DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’, and Non-template strand = 5' - ATGTCGTGAGTCAGT - 3' . If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed and the chain arrangement of the amino acids produced by this mutation?