In proteins, a peptide read from the N terminal to the C terminal. Is there a kind of direction in DNA/RNA as well? Briefly explain. What does Chargaff’s rules mean? Who proposed DNA was a double helix? In what decade?
Q: The underlying structure of DNA is very simple, consisting of only four possible building blocks.a.…
A: DNA (deoxyribonucleic acid) is an information storage molecule and its primary function is to carry…
Q: What are the complementary base pairs in DNA-RNA interactions? Answer format: Base 1(one letter…
A: Nucleic acids are of two types: DNA and RNA. Nucleic acids are the polymer of the nucleotides. It is…
Q: Describe the structure of nucleotides and the manner in which these monomers are joined to form a…
A: A nucleotide is an organic molecule that is the building block of DNA and RNA and also have…
Q: a) In a DNA double helix, why doesn't an A or T form two hydrogen bonds (out of the three possible)…
A: Since you have asked multiple questions with multiple parts, we will answer only the first three…
Q: One strand of a single DNA helix is labeled red while the other strand of the same DNA helix is…
A: Answer: DNA : Deoxyribonucleic Acid is the double stranded helix structure comprises genetic…
Q: Look at the double-stranded segment of DNA shown below. Imagine that the two strands have already…
A: DNA is the nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid in which…
Q: You are given two solutions containing different purified DNAS. One is from the bacterium P.…
A: In biology and genetic science, GC-content (or G-cytosine content) is that the proportion of…
Q: Why is DNA present in a double stranded form and not single stranded in organisms?
A: As we know DNA is the basic unit of inheritance and it resides in a well-protected nucleus. DNA is…
Q: If the sequence of a gene is: 3'TACATACCAACTGAGGATCGC5' 5'ATGTATGGTTGACTCCTAGCG3' And the RNA…
A: DNA is a double stranded helical structure found generally in Eukaryotes and prokaryotes while in…
Q: A double-stranded molecule of B DNA contains 340 nucleotides. How many complete turns occur in this…
A: DNA duplex model proposed by Watson and Crick is right-handedly coiled and is called B-DNA. A DNA…
Q: A DNA strand has the following sequence: 5’-GAACCCGATGGCGATACATTTACCAGATCACCAGC-3’ In which…
A: The deoxyribonucleic acid (DNA) replication involves the multiplication of DNA strands. The DNA is a…
Q: Do any strands of nucleic acid exist in nature in which part of the strand is DNA and another part…
A: DNA RNA hybrid is a formed when one strand is DNA and another strand is RNA. In DNA Thymine is…
Q: Suppose the following base sequence was found in a 20-base DNA polymer. 3'СAGTTAC…
A: DNA, or deoxyribonucleic acid, is a biomacromolecule that is responsible for the transmission of…
Q: If you had a protein that developed a mutation that changed its TEMPLATE strand from 5’GAT 3’ to…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: An RNA molecule has the following percentages of bases: A = 23%, U = 42%, C = 21%, and G = 14%. a.…
A: Ribonucleic acid (RNA) is a polymeric molecule essential in various biological roles in coding,…
Q: In an experiment, you grow bacterial cells for several generations in the presence of a light…
A: Introduction The process by which the genome's DNA is copied in cells is known as DNA replication.…
Q: Based on Chargaff’s rules, if a segment of DNA is composed of 20% adenine (A) bases, what is the…
A: DNA (Deoxyribonucleic acid) is the hereditary material present in most of the living organisms,…
Q: Give the complimentary DNA strand for the following: ACG TAG CTA GTC AGT CGT AGC Give the RNA…
A: NOTE:- Since you have posted a question with multiple sub-parts, we will solve the first three…
Q: If the DNA of one human cell is stretched out, it would be almost 6 feet long and contain over three…
A: DNA DNA is the hereditary unit of an organism which transfer from parents to their offsprings. It…
Q: A portion of one strand of DNA has the sequence 5′ AATGGCTTA 3′. If this strand is used as a…
A:
Q: If the anticodon of a molecule of tRNA has the sequence GAU, what was the original DNA sequence?
A: Question - If the anticodon of a molecule of tRNA has the sequence GAU, what was the original DNA…
Q: the shape of a DNA molecule is a double helix. what makes up the outer regions of the molecule and…
A: DNA possesses a double helical structure that looks like a twisted ladder. Two helices of DNA run in…
Q: The compound known as nitrous acid is a reactive chemical that replaces amino groups (NH2) with keto…
A: Nitrous acid, a potent chemical mutagen, exerts its effect by the deamination of the amino groups of…
Q: The Watson and Crick model of DNA structure shows the following EXCEPT A the turn of the DNA helix…
A: Watson and Crick proposed a specific DNA structure called the 3-dimensional DNA. DNA is comprised of…
Q: Which one of the three parts to a nucleotide is used to determine the 5' to 3' direction of a DNA…
A: A consequence of the structure of nucleotides is that a polynucleotide chain has directionality –…
Q: For numbers 1-3 refer to the statement: The following is the base sequence on one strand of a DNA…
A: "Since you have asked multiple questions, we are eligible to answer only the first three parts.…
Q: 5.1) Do you expect DNA strands 1 and 2 below to have the same melting point? Justify your answer.…
A: As per bartleby guidelines we are only allowed to answer one question. Please post the other…
Q: otal nucleic acids are extracted from a growing culture of yeast cells. They are then mixed with…
A: Although ssDNA could be a critical intermediary in practically all biological activities involving…
Q: Using the coding strand of a DNA molecule below, what will the first 6 bases of the template strand…
A: Coding strand - The strand of DNA whose base pairs sequence is identical to RNA transcript base pair…
Q: A template DNA strand coded for the following sequence: CTCAAGTTATGTATGTCCGATTCGCATGCGCT 1) What is…
A: DNA is the genetic material of the cell which gets transcribed into mRNA with the help of RNA…
Q: Question mentioned in the attachment
A: B form of DNA is considered a right-handed double helix DNA. It tends to runs in opposite directions…
Q: Why is it unfavorable for RNA molecules to adopt a double-helix structure similar to B-DNA?
A: Introduction : Deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) are probably the most…
Q: Which of the following feature/s characterize B-form DNA? I. Two antiparallel, polynucleoside chains…
A: The genetic material in most living organisms is present in the form of deoxyribonucleic acids…
Q: If mRNA is complementary to the DNA template strand and the DNA template strand is complementary to…
A: During the process of transcription, the template strand or non-coding strand of DNA molecule gives…
Q: Tabulate the differences of the various DNA conformations in terms of orientation, rise per base…
A: The DNA duples model proposed by Watson and Crick was right handed spiral known as B-DNA. apart from…
Q: The two strands of a DNA double helix can be separated by heating. If you raise the temperature of a…
A: A double-stranded DNA is joined together by a bond and seems to be a twisted ladder. Which is…
Q: Explain, If the template strand of a DNA is 3’-ATCATG-5’, what will be the complementary strand?
A: The DNA or deoxyribonucleic acid is the genetic material of all the living organisms and it is…
Q: In a single strand of DNA, is it ever possible for the number of adenines to be greater than the…
A: In a DNA molecule purine always pairs with a pyrimidine base. Adenine is a purine base and thymine…
Q: in DNA replication, if the template strand is 5’-ATCCGTGTAACCTT-3’, what is the sequence of the…
A: DNA strand is made up of 4 nitrogenous bases i.e adanine, thymine, guanine & cytosine.
Q: The template strand of a double helical segment of DNA consists of the following sequence: 5’-…
A: Hi! Thank you for the questions. As you have posted questions with multiple subparts, I will be…
Q: If the base sequence on one DNA strand is ATGGCCTAG, what is the sequence on the other strand of the…
A: In order to make the complementary strand we have to look on following things:- DNA → DNA adenine →…
Q: Which of the following is/was a feature of the Pauling-Corey (“P-C") model for DNA (i.e., the…
A: Pauling Corey model for DNA According to them, DNA structure involves three interwindined helical…
Q: Which statement correctly explains the chemical basis of Chargaff's rules? Specific purines and…
A: Chargaff’s rules state that in double-stranded DNA, the number of A nucleotide is always equal to…
Q: A strand of nucleic acid is defined by its sequence of nucleotides: A, C, T, and G. How many…
A: Nucleic acids are large biomolecules or biopolymers which is vital for each known form of life. The…
Q: Given a sequence of a DNA coding strand: 5’-ATGATTATCCTATAG-3’ What is the sequence and…
A: The complementary DNA sequence of DNA coding strand ATGATTATCCTATAG is TACTAATAGGATATC.
Q: a. There are three nucleotides in each codon, and eachof these nucleotides can have one of four…
A: The genetic code is a system of principles that live cells employ to convert data contained in…
Q: Electric Forces in Biology• Describe how a water molecule is polar.• Explain electrostatic screening…
A: Since we only answer 1 question in case of multiple questions, we’ll answer the first question as…
Q: What does it mean when we say that the two DNA strands in thedouble helix are antiparallel? What…
A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…
Q: What is the best description of how the two strands are aligned with each other in the double helix…
A: Introduction :- Humans and nearly all other species carry their genetic information in DNA, also…
- In proteins, a peptide read from the N terminal to the C terminal. Is there a kind of direction in DNA/RNA as well? Briefly explain.
- What does Chargaff’s rules mean?
- Who proposed DNA was a double helix? In what decade?
- If one DNA single strand has the sequence 5’-AATGCAA-3’, what is the sequence of its complementary strand?
- When
DNA replicates , how is it able to “unwind” its double helix?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- State the properties of the WatsonCrick model of DNA in the following categories: a. number of polynucleotide chains b. polarity (running in same direction or opposite directions) c. bases on interior or exterior of molecule d. sugar/phosphate on interior or exterior of molecule e. which bases pair with which f. right- or left-handed helixGiven the following DNA sequence: 5’-ATGCGGCCAAGGTCAGAGTGACA-3’ a) If this DNA strand represents the “Sense Strand” of DNA, what would be the RNA sequence? b) If this DNA strand represents the “Antisense Strand” of DNA, what would be the RNA Sequence? c) What would be the other strand of DNA?Do any strands of nucleic acid exist in nature in which part of the strand is DNA and part is RNA? If so, a.describe when such strands of nucleic acid are synthesized. Is the RNA component at the 5' end or at the 3' end?
- The following diagram of a generalized tetranucleotide will serve as a basis for the three questions marked “a” through “c.” (02) (a) Is this a DNA or an RNA molecule? State which _________ (b) Place an “X” (in one of the circles provided) at the 3' end of this tetranucleotide. (c) Given that the DNA strand, which served as a template for the synthesis of this tetranucleotide, was composed of the bases 5'- A C A G - 3', fill in the parentheses (in the diagram) with the expected basesThe compound known as nitrous acid is a reactive chemical that replaces amino groups (−− NH2) with keto groups (== O). When nitrous acid reacts with the bases in DNA, it can change cytosine to uracil and change adenine to hypoxanthine. A DNA double helix has the following sequence: TTGGATGCTGG AACCTACGACC A. What would be the sequence of this double helix immediately after reaction with nitrous acid? Let the letter H represent hypoxanthine and U represent uracil. B. Let’s suppose this DNA was treated with nitrous acid. The nitrous acid was then removed, and the DNA was replicated for two generations. What would be the sequences of the DNA products after the DNA had replicated twice? Your answer should contain the sequences of four double helices. Note: During DNA replication, uracil hydrogen bonds with adenine, and hypoxanthine hydrogen bonds with cytosine.Do any strands of nucleic acid exist in nature in which part of the strand is DNA and another part of that same strand is RNA? If so, describe when such strands of nucleic acid are synthesized. Is the RNA component at the 5′ end or at the 3′ end?
- Which complementary base pair, G-C or A-T, would be hardest to break apart when a double-strandedDNA helix unwinds during cellular processes?The two strands of a DNA double helix can be separated by heating. if you raised the temperature of a solution containing the following three DNA molecules, in what order do you suppose they would “melt”? explain your answer.A. 5’-GCGGGCCAGCCCGAGTGGGTAGCCCAGG-3’ 3’-CGCCCGGTCGGGCTCACCCATCGGGTCC-5’ B. 5’-ATTATAAAATATTTAGATACTATATTTACAA-3’ 3’-TAATATTTTATAAATCTATGATATAAATGTT-5’C. 5’-AGAGCTAGATCGAT-3’ 3’-TCTCGATCTAGCTA-5’If the sequence of a gene is: 3'TACATACCAACTGAGGATCGC5' 5'ATGTATGGTTGACTCCTAGCG3' And the RNA that is transcribed from this gene is: 5'AUGUAUGGUUGACUCCUAGCG3' Which strand of the DNA - top or bottom - is the template strand? Explain how you know.
- why can we not describe the “average” behavior of a DNA molecule? Why is it improbable that proteins needed for DNA structure, for example, form spontaneously from random amino acids?The following is diagram of a generalized tetranucleotide. Carbons exist at corners on the shapes and phosphate groups are filled circles. A. Is this a DNA or an RNA Molecule? B. Where is the 3’ end of this tetranucleotide? C. Given that the DNA strand which served as a template for the synthesis of this tetranucleotide was composed of the bases 5’-ACAG-3’, where are the expected bases?In a DNA Double helix ,why doesn't an A or T form two hydrogen bonds(out of the three possible) with G or C? Explain in detail.