If DNA segments changes from GCATAG to GCATGG, this is a:MRNA Codon/Amino Acid ChartFirst BaseSecond BaseThird BaseAGUUU1 PhenylalanineUCUTUAUTFTyrosine (Tyr)UACUGU,UFCysteine (Cys)UGCJUUCJ (Phe)UCCSerine (Ser)UCAUUGA - StopAUUA1FLeucine (Leu)UUG-UAA1FStopUAGJUCG-UGG - Tryptophan (Trp)GCUUCAU1CCU1CGUTHistidine (His)CAC-CUCCCCProline (Pro)CCACGCFLeucine (Leu)CUAFArginine (Arg)CGACAA1 GlutamineACAGJ (Glu)CGG-CUG-CCG-ACUAAUJ AsparagineAUUTAGUTFSerine (Ser)AGC-UAUC FIsoleucine (lle) ACCAACJ(Asn)ThreonineAAUA-(Thr)AAA1FLysine (Lys)AAG-АСАAGA,FArginine (Arg)AGG-AStart MethionineAUG- (Met)ACG-GGUUGCU,GAU1 Aspartic AcidGGUUGAÇJ(Asp)GUCFvaline (Val)GUAGCCGGCGAlanine (Ala)GCAGlycine (Gly)AGAAJ Glutamic Acid GGAGAG- (Glu)GUG-GCG-GGG-G

Name: If DNA segments changes from GCATAG to GCATGG, this is a:MRNA Codon/A
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: If DNA segments changes from GCATAG to GCATGG, this is a:MRNA Codon/Amino Acid ChartFirst BaseSecond BaseThird BaseAGUUU1 PhenylalanineUCUTUAUTFTyrosine (Tyr)UACUGU,UFCysteine (Cys)UGCJUUCJ (Phe)UCCSerine (Ser)UCAUUGA - StopAUUA1FLeucine (Leu)UUG-UA

The DNA sequence GCATAG will have the mRNA code CGUAUC. When the sequence changed to GCATGG, then…

Science

Biology

If DNA segments changes from GCATAG to GCATGG, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base U A G UAU1 FTyrosine (Tyr) UACJ UGU, Cysteine (Cys) UGCJ 001 Phenylalanine UCU UUCJ (Phe) UCC Serine (Ser) UCA U UGA - Stop A UUA1 FLeucine (Leu) UUG- UAA1 FStop UAGJ UCG- UGG - Tryptophan (Trp) G CAUT CGUT CUUT CCU1 U Histidine (His) CAC CUC ССС Proline (Pro) ССА CGC FLeucine (Leu) CUA FArginine (Arg) CGA CAA1 Glutamine A CAGJ (Glu) CGG- CUG- CCG- G ACU AAU1 Asparagine AGU1 Serine (Ser) AGC- AUUT U AUC FIsoleucine (lle) ACC AACJ (Asn) Threonine (Thr) A AUA- AAA1 FLysine (Lys) AAG- АСА AGA, FArginine (Arg) AGG- A Start Methionine AUG- (Met) ACG- G GUU GCU, GAU1 Aspartic Acid GGU U GAÇJ(Asp) GUC Fvaline (Val) GUA GCC Alanine (Ala) GCA GGC G Glycine (Gly) GAAJ Glutamic Acid GGA A GUG- GCG- GAGJ (Glu) GGG- G

If DNA segments changes from GCATAG to GCATGG, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base U A G UAU1 FTyrosine (Tyr) UACJ UGU, Cysteine (Cys) UGCJ 001 Phenylalanine UCU UUCJ (Phe) UCC Serine (Ser) UCA U UGA - Stop A UUA1 FLeucine (Leu) UUG- UAA1 FStop UAGJ UCG- UGG - Tryptophan (Trp) G CAUT CGUT CUUT CCU1 U Histidine (His) CAC CUC ССС Proline (Pro) ССА CGC FLeucine (Leu) CUA FArginine (Arg) CGA CAA1 Glutamine A CAGJ (Glu) CGG- CUG- CCG- G ACU AAU1 Asparagine AGU1 Serine (Ser) AGC- AUUT U AUC FIsoleucine (lle) ACC AACJ (Asn) Threonine (Thr) A AUA- AAA1 FLysine (Lys) AAG- АСА AGA, FArginine (Arg) AGG- A Start Methionine AUG- (Met) ACG- G GUU GCU, GAU1 Aspartic Acid GGU U GAÇJ(Asp) GUC Fvaline (Val) GUA GCC Alanine (Ala) GCA GGC G Glycine (Gly) GAAJ Glutamic Acid GGA A GUG- GCG- GAGJ (Glu) GGG- G

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
Most codons specify an _________ . a. protein c. amino acid b. polypeptide d. mRNA
Figure 28.41 gives some examples of recombination in IgG codons 95 and 96, as specified by the Vkand Jkgenes. List the codon possibilities and the amino acids encoded if recombination occurred in codon 97. Which of these possibilities is less desirable?
The following segment of DNA in a hypothetical model organism encodes a polypeptide containingSEVEN amino acids. Pretend this short polypeptide is a completely functional enzyme. DNA tripletsencoding the translation initiation (or start) codon and a stop codon are included in the sequence.3 •GGGTACGATCGGAAAGTTGGTTCICCGGTATAGCTG5'5•CCCATGCTAGCCTTTCAACAAAGAGGCCATATCGAC.3'a. Label which of the DNA strands is the template strand and which is coding strand. b. Below, show sequence and the polarity of the mRNA encoded by this 'gene'. Determine theamino acid sequence of the polypeptide (use three letter codes for the amino acids) andidentify the N- and C- terminal ends of the polypeptide. please help. I am confused. c. Which of the 7 side chains in this polypeptide can form hydrogen bonds with polar molecules(like water)? Place a circle around these.d. Some amino acids on a polypeptide can be modified post-translationally. Thesemodifications may have some effect on the function of the…
Translate the mRNA into a protein using the genetic code. (Amino acid chain.) AUG( met)-UUU( Phe)-GUA( Val) - CAU (his)-UUG(leu) -UGU(cys)- GGG(gly)- AGU(ser)- CAC (his) - CUG(leu) GUU(Val)- GAG (Glu)-GCG(ala)- UUG(Leu)- UAU(tyr)- UUG (leu)-GUU(Val)- UGU(cys)- GGC(gly)-GAG( Glu)-CGC(arg) - GGC(gly) - UUU(phe) - UUC(phe).
Using the codon table, identify a 5’-3’ sequence of nucleotides in the dna template strand for mRna coding for the polypeptide sequence NH2-PHe-Pro-lys-COOH.
A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)
A strand of DNA contains this nucleotide sequence: TACTGCCTCCCCATAAGAATT. The corresponding nucleotide sequence of the mRNA strand from this DNA template is as follows: AUGACGGAGGGGUAUUCUUAA. Q: What is the amino acid sequence of the polypeptide that is produced form the mRNA strand? As well, draw a labelled diagram of the mRNA molecule being transcribed from this strand of DNA.
The genetic code consists of a series of three-base wordsthat each code for a given amino acid.(a) Using the selections from the genetic code shown below, de-termine the amino acid sequence coded by the following seg-ment of RNA: UCCACAGCCUAUAUGGCAAACUUGAAG AUG= methionine ;CCU= proline; CAU= histidine ;UGG= tryptophan AAG= lysine ; UAU= tyrosine ;GCC= alanine ;UUG= leucine ;CGG= arginine ;UGU= cysteine ;AAC =asparagine ;ACA=threonine ;UCC= serine ;GCA=alanine ;UCA=serine(b) What is the complementary DNA sequence from which this RNA sequence was made? (c) If you were sequencing the DNA fragment in part (b), how many complementary chain pieces would you obtain in the tube containing ddATP?
From this DNA sequence DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’, change the third base in codon 4 to show missensemutation. Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:Identify the type of base pair substitution that you applied in codon 4
mRNA sequence of A gene Write the amino acid sequence of the gene A. 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCCUACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACGACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGCUGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGAGGUAGAAGCCGCUGGGGCUUGGGGCU-3’
Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’