An mRNA transcript is listed below and contains both start and termination codons. Assume that the initial methionine will stay on the polypeptide in this case.  What amino acid sequence will be specified during translation? List the amino acids. The start codon is highlighted. 5’ – CAGCCAAGCAUGCUCGCAAAUGGACGUUGAUAUUUUGUC – 3’

Q: UAA is a stop codon. Why does the UAA sequence in the segment of mRNA…

A: Stop codons do not specify any amino acid. When ribosome faces any stop codon, it stalls. When the…

Q: Which of the following is NOT an event associated with translation termination?   A stop codon…

A: Hi, Thanks For Your Question.  Answer : Correct Option Is A terminal amino acid is added to the…

Q: During the termination of translation, what is the correct polypeptide sequence which will be…

A: DNA is the storehouse of genetic information. This information age expect by the formation of an…

Q: Assume the following portion of an mRNA. Find a start signal, and write the amino acid sequence that…

A: The sequence of protein is usually notated as a string of letters, according to the order of the…

Q: What MRNA sequence codes the tripeptide shown below (write code in direction of N-terminus to…

A: Peptides are present in all individuals which are living. Peptides play may functional roles in our…

Q: The following diagram illustrates a step in the process of translation. Identify the following…

A: The translation is a process through which a polypeptide chain is synthesized based on the sequence…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine,  The possible codons can be  CCG CGC GCC GGC GCG CGG

Q: Consider this list (below) of steps involved in translation. These steps are out of order.…

A: Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum generate…

Q: Using the Genetic Code Table in Figure 1.3, what is the proper sequence of amino acids in the…

A: DNA ( Deoxyribonucleic acid ) is two stranded ladder like structure which act as genetic material in…

Q: Which of the following represents the sequence of an RNA transcript for which the template strand of…

A: The deoxyribonucleic acid (DNA) is the nucleotide sequence that stores the genetic information of an…

Q: Which of the following best describes a sequence of events that happens during the elongation phase…

A: The translation is a process by which protein is synthesized using mRNA as a template. This process…

Q: Draw a line between the codons for each strand of MRNA: 1. AGGUCAUGCAUGGGCAUGCAU 2.…

A: BASIC INFORMATION  GENETIC CODE  These are the codes which helps in the formation of the protein…

Q: describe, using diagrams etc., how information stored in the DNA is translated into a peptide. Be…

A: Usually Central dogma of Molecular Biology is followed during the process of protein synthesis which…

Q: If there are 64 possible codons in the genetic code and the amino acid is specified by each, as read…

A: Protein synthesis is described as the process that ultimately results in the formation of proteins.…

Q: How many open reading frames are present in the following mRNA sequence? You may find the codon…

A: An open reading frame in molecular genetics describes the part of your reading frame that has the…

Q: An mRNA has the following sequence: 5' ACCAUGUACUGUCCUGCUGUUUGA 3'. Beginning from the start codon,…

A: In Amazon instant there are four type of nucleotide bases i.e adenine, guanine, cytosine and uracil.…

Q: For translation, identify two things that happen during each step - initiation, elongation and…

A: Translation is a complex process it is the final formation of protein with the help of m RNA, t RNA…

Q: The following segment of DNA in a hypothetical model organism encodes a polypeptide containing SEVEN…

A: Francis Crick proposed central dogma. The RNA is formed from DNA with the help of enzyme RNA…

Q: LIOCTOTmats Provide the three-letter amino acid sequence expected from each of the following mRNA…

A: Question - 1- Provide the three-letter amino acid sequence expected from each of the following mRNA…

Q: An mRNA has the following base sequence:5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′Identify the start…

A: Hereditary qualities are a piece of science stressed over the examination of qualities, hereditary…

Q: Write the amino acid for the codons below 5'-AUG UUC CAG CUA GAU GAU AUG CUG GUA AUU GGG GAA CGC…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: You have an mRNA transcript that is 201 nucleotides long, including the Start and Stop codons.  How…

A: In most living organisms, DNA is the genetic material. DNA contains all the genetic instructions…

Q: For this RNA code, what is the final codon ? UACACGCCAGAGGUCGCCUUUACA

A: Introduction :- a DNA or RNA molecule that codes for a particular amino acid through a group of…

Q: In prokaryotic protein synthesis, formylmethionine (fmet) is the first amino acid incorporated,…

A: Methionine which is a central molecule in one-carbon metabolism is an essential amino acid needed…

Q: Translate the following mRNA into protein, starting from the first initiation codon:…

A: Translation is the process of synthesis of protein from an mRNA. mRNA synthesized through…

Q: What will be the overall anti-codon sequence in tRNA for this mRNA?…

A: Proteins are synthesized from DNA in two step process. These two processes are transcription and…

Q: Which of the following statements regarding the genetic code is false? The genetic code is…

A: Genetic code is used for ways in which the four bases of DNA- - the A, C, G, and Ts- - are hung…

Q: A mRNA strand is 5’ to 3 across the translation initiation complex. The start codon is ____ And…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Consider the mRNA sequence below. Assume that the following mRNA segment has been translated.…

A: The genetic code is a set of three-letter combinations of nucleotides called codons, each of which…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: The amino acids are coded by the group of three bases called base triplets and codons.

Q: Which translation factor mediates the aminoacyl-tRNA entry into the A site of the ribosome? A.…

A: The translation process is responsible for synthesizing the protein in the cytoplasm of the cell.…

Q: The mRNA formed from the repeating tetranucleotide UUACincorporates only three amino acids, but the…

A: Answer- According to the genetic code, all the 20 amino acids are coded by 64 set codons of…

Q: What is the order of the polypeptide chain shown in the images provided?    Starting at the…

A: Translation is the process of synthesizing proteins from RNA template through series of reactions on…

Q: The codon and anticodon are base-paired together during the process of translation. Which of the…

A: The central dogma of molecular biology involves the transfer of information from DNA to proteins…

Q: Assume that the following mRNA segment has been translated.   5’-UACCGAAUGUCU-3’   Note for…

A: Translation is the process during which codons in mRNA are identified by tRNA with specific…

Q: Refer to the codon diagram on. Which of the following is a codon that will terminate translation? *…

A: The process of formation of a polypeptide sequence from an mRNA transcript is known as translation.…

Q: For the codon sequence :                      5’ GGA – AUA – UGG – UUC – CUA – 3’…

A: The translation is the process in which proteins are synthesized from the RNA. The ribosome and tRNA…

Q: The images shown depict the initiation and elongation steps in protein translation. Arrange the…

A: The amount of mRNA which is define with the mechanism that is usually produced by a gene is limited,…

Q: Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is…

A: Untranslated regions are present in RNA which are transcribed but not translated on either end of…

Q: A small section of bacterial mRNA has the following nucleotide sequence: GAC CCG AUG AAC The tRNA…

A: Translation  It is the synthesis of proteins from the codons present in the mRNA. Anticodons…

Q: The following diagram illustrates a step in the process of translation. Identify the following…

A: Translation is the process of formation of protein from mRNA As in the question above start codon is…

Q: The following diagram illustrates a step in the process of translation. Identify the following…

A: The diagram illustrates the process of elongation of polypeptide chain by adding amino acids one by…

Q: In panel a (see picture), a tRNA is already bound to the initiator codon at the start of the mRNA…

A: The central dogma states that the genetic information will flow from DNA to RNA and then to protein,…

Q: Below is the sequence from the 3' end of an mRNA. S'..CCGUUACCAGGCCUCAUUAUUGGUAACGGAAAAAAAAAAAAAA-3'…

A: The eukaryotic premature mRNA is synthesized without the poly-A tail. The poly-A tail is added at…

Q: Indicate the amino acid sequence of the protein encoded by the following mRNA molecule.  Use the…

A: Transcription is the process in which the synthesis of RNA takes place by using deoxyribonucleic…

Q: The following sequence is from the template strand of a bacterial gene, and it includes the…

A: According to the central dogma of the molecular theory, the information stored in DNA is first…

Q: Below is a picture of a ribosome. Name and give a function of all the “players” of translation found…

A: In molecular biology, when the ribosomes present in the cytoplasm or endoplasmic reticulum…

Q: Which of the following mRNA codons signals the start of translation in eukaryotic cells? 5’-UGA-3’…

A: There are 3 stop codons: UAG(Amber) UAA(ochre) UGA(umber) These codons signal the termination of…

Q: Consider the following portion of mRNA: 3'-CUU-AAA-CGA-GUU-5' What is the primary amino acid…

A: mRNA(messenger RNA) carries the genetic information copied from DNA in the form of a series of…

Q: Consider the mRNA sequence below. Assume that the following mRNA segment has been translated.…

A: Translation is the process of synthesis of proteins from mRNA. During the process of translation,…