Viruses are neither prokaryotes or eukaryotes, yet prokaryotes and eukaryotes can both be infected by viruses. What are two key features that must be part of SARS-CoV2 messenger RNA for the mRNA to be translated in human cells?

Viruses are neither prokaryotes or eukaryotes, yet prokaryotes and eukaryotes can both be infected by viruses. What are two key features that must be part of SARS-CoV2 messenger RNA for the mRNA to be translated in human cells?

Name: Viruses are neither prokaryotes or eukaryotes, yet prokaryotes and euk
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Viruses are neither prokaryotes or eukaryotes, yet prokaryotes and eukaryotes can both be infected by viruses. What are two key features that must be part of SARS-CoV2 messenger RNA for the mRNA to be translated in human cells?

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 4CT

See similar textbooks

Similar questions

Here is a partof the mRNA sequence of the spike glycoprotein of the SARS Covid-19 virus, starting with the start codon. A deletion was found in 6 bp (underlined). How will this change affect the polypeptide sequence? >S_protein AUGUUUGUUUUUCUUGUUUUAUUGCCACUAGUCUCUAGUCAGUGUGUUAAUCUUACAACCAGAACUCAAUUACCCCCUGCAUACACUAAUUCUUUCACACGUGGUGUUUAUUACCCUGACAAAGUUUCAGAUCCUCAGUUUUACAUUCAACUCAGGACUUGUUCUUACCUUUCUUUUCCAAUGUUACUUGGUUCCAUGCUAUACAUGUCUCUGGGACCAAUGGUACUAAGAGGUUUGAUAACCCUGUCCUACCAUUUAAUGAUGGUGUUUAUUUUGCUUCCACUGAGAAGUCUAACAUA
Researchers have been determining the nucleotide sequences of variant forms of SARS-CoV-2, looking for versions of the virus that might be more easily transmitted between humans or that might be more deadly. (a) For example, one mutation in a viral gene changed a GAU codon to a GGU codon. How does this change affect the sequence of the polypeptide encoded by that gene? (b) In another variant form of the virus, a gene is missing six consecutive nucleotides. How would this change affect the sequence of the polypeptide encoded by that gene? (c) In another coronavirus variant, the spike protein (the prominent protein on the surface of the virus) contains a histidine residue where an aspartate (aspartic acid) residue should be. Describe a point mutation in the coronavirus genome that could have caused this change in the spike protein.
In a typical mammalian cell, about 80% of all of the RNA consists of ribosomal RNA, and another approximately 10% consists of transfer RNA. Why are these types of RNA so abundant?
In the study of the SARS-CoV virus protein codes, it was discovered that eight potential open reading frames (ORFs) encode hypothetical SARS‐CoV‐specific proteins which lack obvious sequence similarity to known proteins. What possible function could these proteins have that would add to the infectious quality of the virus?
The new Covid19 vaccine produced by two companies (Pfizer, Moderna) uses mRNA coding for part of the spike protein of the virus. The virus uses the spike protein to invade human cells where it replicates. Is it surprising that the mRNA must be stabilized with chemicals that need ultra-cold or frozen storage to protect the mRNA from degradation before it causes human muscle cells to make the spike protein?
Hemophilia in the Russian royal family was caused by defective protein involved in blood clotting (factor IX). This defective protein was caused by a mutation that altered the splicing of the exons. This genetic change in the splicing pattern created a new stop codon in the mRNA for factor IX. What effect might this new stop codon have on the primary and tertiary levels of the mutant factor IX protein (compared to the native or wild-type protein).
Shown here is a theoretical viral mRNA sequence 5′-AUGCAUACCUAUGAGACCCUUGGA-3′ (a) Assuming that it could arise from overlapping genes, how many different polypeptide sequences can be produced? Using the chart in Figure 12–7, what are the sequences? (b) A base-substitution mutation that altered the sequence in part (a) eliminated the synthesis of all but one polypeptide. The altered sequence is shown below. Use Figure 12–7 to determine why it was altered. 5′-AUGCAUACCUAUGUGACCCUUGGA-3′
What are two key features that must be part of SARS-CoV2 messenger RNA for the mRNA to be translated in human cells
So I know that most DNA viruses use the cell’s DNA-dependent RNA polymerases to make mRNAs for translation, but since RNA viruses don’t have RNA-dependent RNA-polymerases, RNA viruses (like influenza) bring their own RNA-dependent RNA polymerases. And to protect viral mRNAs from degradation through exconucleases and facilitate their efficient translation by ribosomes, RNA viruses (influenza) snatch 5’-caps from host mRNAs. But can you please explain how influenza virus does cap snatching in details?
The new Covid19 vaccine produced by two companies (Pfizer, Moderna) uses mRNA coding for part of the spike protein of the virus. The virus uses the spike protein to invade human cells where it replicates. Is it surprising that the mRNA must be stabilized with chemicals that need ultra-cold or frozen storage to protect the mRNA from degradation before it causes human muscle cells to make the spike protein? Some Covid 19 vaccines in development use the adenovirus, a common vector used in gene therapies, to inject the mRNa for the spike protein into human muscle cells. Why might vaccines using a virus vector be more likely to need only refrigeration and not deep-cold storage, given what you know about viruses? Some older vaccines used a weakened strain of the pathogenic virus in the injection in the hope that the weakened virus would induce an immune response without causing disease. The virus vectors used in genetic engineering have all the harmful virus genes cut out and replaced with…
Hemophilia in the Russian royal family was caused by defective protein involved in blood clotting (factor IX). This defective protein was caused by a mutation that altered the splicing of the exons. This genetic change in the splicing pattern created a new stop codon in the mRNA for factor IX. What effect on the polypeptide chain of factor IX would this new stop codon have?
What is its functional difference with the RNA polymerases found in both eukaryotic and prokaryotic cells?