We have the following DNA sequence that codes for 7 amino acids of exon 1 of the dopamine receptor gene. 5’- GTG CAC CTG ACT CCT GAG AAG -3’ a. Obtain the sequence of the complementary strand to said DNA sequence: b. Obtain the sequence of the messenger RNA and indicate which direction it leads: c. Using the genetic code obtain the protein sequence: d). What effect would it have on the cells, in terms of their receptor for dopamine, if there was a stop codon in the third position in that mRNA sequence?

Q: A turkey ordorant molecule comes in contact with the pie ordorant receptor. Would this have an…

A: The receptors involved in sense of smell are present in the olfactory epithelium of the nose.

Q: A scientist hypothesizes that dysregulated insulin signaling is responsible for the development of…

A: Metabolic syndrome A cluster of conditions that increase the risk of heart disease, stroke and…

Q: Which is most important in catalysis of peptidyl transfer? A Massively parallel sequencing data…

A: Peptidyl transferase is used in the process of translation where protein is synthesized. Proteins…

Q: You are studying a pathogenic bacterium which secretes a toxin that affects G protein receptor…

A: The cAMP signaling pathway, commonly referred to as the adenylyl cyclase pathway, is a cell…

Q: Describe how Separase, plays a critical role during meiosis and mitosis.

A: Introduction Mitosis and meiosis are the two kinds of cell division. When people say "cell…

Q: both complex I and complex II send electrons to cytochrome c, how many cytochrome c molecules will…

A: Electrons from Nadh pass through a flavoprotein to a series of iron sulphur proteins in complex I to…

Q: Question z Methanogens are always engaged in relationships with other microbes because methane…

A: Answer- interspecies hydrogen Transfer.  Interspecies hydrogen transfer (IHT) is a form of…

Q: Which of the following is a correct representation of a segment of DNA? 1. 5'ATTC3' 4. 'ATAG3'…

A: A DNA segment has two strands - coding strand and non coding strand. Coding strand is represented in…

Q: Describe all of the ways in which RNA is modified after transcription in eukaryotic cells

A: Transcription of creating RNA from a template of DNA. It can be found in the nucleus of eukaryotes.…

Q: My field is COSMETIC SCIENCE What information can be obtained from UV-vis Spectra and how this can…

A: Ultraviolet Visible spectroscopy (UV-Vis spectroscopy) is an analytical technique, which measures…

Q: Question 16 The fact that some eukaryotic FRNAS are self-splicing indicates that (A RNA can contain…

A: Nucleus is main controller of the cell which possess genetic information . It also contain long…

Q: MULTIPLE CHOICE. A B C D or Duhh 1) Molecules assisted by a transport protein may cross a selective…

A: Introduction :- Active transport is the movement of molecules across a cell membrane against a…

Q: How does temperature and PH affect the activity of enzymes.

A: Introduction - Enzymes are proteins that help a person's body's metabolism, or chemical reactions,…

Q: You are working with a yeast that can undergo fermentation or respiration. You take equal aliquots…

A: Introduction - Fermentation in yeasts produces ethanol and carbon dioxide, both of which can be used…

Q: The counterstain in the Gram stain is: A basic dye A negative stain A mordant An acid dye Necessary…

A: Staining is a method for enhancing contrast in material, usually on a tiny scale. Histology, as well…

Q: Explain briefly the mechanism of Magnetic Resonance Imaging (MRI) and how is Ampere's Law applied in…

A:

Q: estrogen receptor (ER)-positive or -negative.

A: Cancer : The condition where the cells in a specific part of the body grow and reproduce…

Q: True or False The physical life is always greater than all the other “life” factors under…

A: Answer: false because the physical life is not always greater than aal the other life factors under…

Q: What plant process involved in your experiment aside from transpiration?

A: Plants are vital living forms that belong to the Plantae taxonomic kingdom and are further classed…

Q: -If the first G get deleted what kind of mutation will happen? Show the change in amino acid…

A: Any Change in the genetic material, which is not caused by recombination, that leads to altered…

Q: Genetic problems: Use the diagram below to figure out how each monosomy or trisomy can a) Normal X…

A: 1) Trisomies and monosomies are two types of chromosomal abnormalities. Specifically, a trisomy is…

Q: Match the letter to the appropriate bone. Im A d Im

A: Introduction:- The core framework of body is the skeletal system.It is composed of bones as well as…

Q: Which of the following is not true about a gram-positive cell wall? It has plasma membrane inside…

A: Introduction :- The Gram-positive cell wall is made up of many interconnected peptidoglycan layers…

Q: Generally, one single mutation is enough to cause cancer. [Select] Cancer-causing mutations cause…

A: When the genes that control cell division are disrupted, cancer cells are produced. Carcinogenesis…

Q: If an antisense RNA is designed to silence the following mRNA sequence, which of the following…

A: mRNA sequence:-5' UAGGACUAUUAAGGUACACCCAUU 3' to silence this sequence the antisense RNA should be…

Q: Marie diluted her phage lysate from 10° to 109. She completed the titer assay protocol using these…

A: This question is about dilution.

Q: principle of a plant virus that transmits through an animal vector

A: A virus is a small microscopic infectious microbe that is non-living until and unless it finds a…

Q: Why isn’t cDNA synthetic

A: INTRODUCTION Deoxyribonucleic Acid, or DNA, is a molecule that holds the instructions that an…

Q: Compare and contrast the immune system/immune response between plants and animals using a Venn…

A:

Q: You have a photoreceptor cell in a dish. You are recording its membrane potential while flashing…

A: Answer :- Option (B) is correct. - The cell depolarizes, with brighter light causing more…

Q: You are supplied with the following information about a DNA molecule:  The molecular weight of a…

A: Introduction DNA is an organic molecule that includes genetic information as well as instructions…

Q: The students of a Microbiology class were tasked to transfer or subculture a pure culture of…

A:

Q: 1 Why is the bulk milk hauler an important link in assuring high-quality milk for humans? What…

A: Bull milk contain high amount of calcium and minerals. These are necessary for bone develpoment.…

Q: A. You are crossing bunnies. The haplotype of a female bunny, Poppy, is as shown in the diagram…

A: In its broadest definition, a haplotype is a collection of DNA changes along a chromosome that tend…

Q: The walls of vessels have rather significant morphological differences in the structure of the…

A: The three major types of blood vessels are arteries, veins and capillaries. Arteries carry…

Q: 4. The diagram illustrates the activity of vesicles during a cellular process. Which statement best…

A: Golgi body use to release the vesicles which contain the material of the cell. The main function of…

Q: what structure is present in both plant and yeast cells, but not in a bacterial cell?

A: Introduction :- Yeasts are single-celled fungi that produce daughter cells either by budding…

Q: How do climate change and extreme weather conditions (i.e. typhoons) affect the water management…

A: Introduction Climate change is already affecting life in Asia. as an example, rising temperatures…

Q: Dinitrophenol (DNP) is a lipid soluble H+ binding drug that equalizes the H+ concentration across…

A: dinitrophenol is essentially an organic molecule with the formula HOC6H3(NO2)2. It's a pleasant,…

Q: 1.  How do clams open and close their shells? 2. How does a clam draw water into its mantle cavity?…

A: Clams are bivalves that spend most of their time lying on the seafloor. When frightened, a clam uses…

Q: Describe not just list 4 adaptations that allow plants to cope with these challenges, 2 for coping…

A: The transition of plants from water to land Liverworts are believed to be the first plants that…

Q: Think of reasons why it is important to maintain the number and structure of chromosomes

A: Genes are passed from parent to child making each of us unique.Chromosomes are thread-like…

Q: happens when traits become more common in a population because of the reproductive success of…

A: Mechanical isolation is defined as the physical incompatibility between the reproductive organs of…

Q: How could immunoglobulin cross-reactivity between foreign antigens and host cell antigens result in…

A: Introduction Immunoglobulins are antibodies produced naturally by the immune system of the body that…

Q: Why would vaccination be more likely to eradicate a viral disease than a bacterial disease? Why can…

A: The last case of Smallpox happened in 1977. Edward Jenner first introduced vaccine of Small pox.…

Q: What causes allele frequencies to differ between biological populations?

A: Allele  frequency  Allelic frequency can be defined as relative frequency of an allele at a…

Q: Identify if the following statements are true or false. Quantitative PCR is also known as the…

A: A real-time polymerase chain reaction is a molecular genetics lab technology that involves the…

Q: Question 64 The vertebrates that lack jaws are called O rays. O turtles. O lampreys. O eels. MacBook…

A: Since you have asked multiple questions from different topics at a same time we will answer only 1st…

Q: The current estimate is that mammalian B cells are capable of producing 1,010 different…

A: Immunoglobulins are composed of four polypeptide chains out of which two are heavy chains and two…

Q: Which 2 systems work together to bring in and deliver oxygen to the cells and get rid of carbon…

A: Introduction :- The circulatory system transports wastes and supplies oxygen and nutrients to cells.…

Cell Signaling

It allows cells to perform various cellular activities, coordinate, and interact with other cells. All cells of an organism receive signals from their environments and respond accordingly. Even the unicellular eukaryotes receive signals secreted by other cells and respond. In the case of yeast, mating takes place by signaling between the yeast cells. Communication by cell signaling in a multicellular organism has become a vast and important part of various fields of biology.