What are “forcefields” and how are they used in predicting how a protein sequence will fold?
Q: how can you determine if a protein sequence is functional using amino acids?
A: A protein is a polymer of amino acid. The primary structure of protein begins with the amino…
Q: What type of bonding interaction causes stem-loops to form?
A: Stem loop is also known as hairpin loop structure. It is an intramolecular base pairing that…
Q: Which of the following is most commonly the rate limiting step in determining the structure of a…
A: X-ray crystallography (XRC) is a widely used experimental technique to determine the macromolecule…
Q: How does a deeper understanding of primary amino acid sequence and identification of specific…
A: Proteins are unbranched polymers constructed from 22 standard α-amino acids. They have four…
Q: Describe how two protein sequences are aligned, and how one can determine whether that alignment is…
A: Sequence alignment is a way of arranging protein sequences to identify regions of similarity that…
Q: Suppose you performed two BLAST searches, one on the peptide sequence FIDPWE, and another on the…
A: BLAST is a computer algorithm that is available for use online at the National Center for…
Q: In protein analysis, these macromolecules need different correction factors because they have…
A: Proteins are vital biomolecules, these help in building the muscle mass in the human body. Proteins…
Q: What experimentally derived information led to Holley’s proposal of the two-dimensional cloverleaf…
A: Introduction: The structure of tRNA was first elucidated by Holley for the amino acid alanine. Its…
Q: What are the three major types of RNA molecules? How is eachrelated to the concept of information…
A: Ribonucleic acid is a polymeric molecule essential in various biological roles in coding, decoding,…
Q: three main steps in protein sorting?
A: To maintain the fidelity of macromolecule transport, elaborate macromolecule sorting machinery is…
Q: Using sickle-cell anemia as a basis, describe what is meant by a genetic or inherited molecular…
A: A disease is an abnormal condition of the body or body that does not work properly and causes a…
Q: “Through protein engineering, we can get a protein with better robustness, & better stability”-…
A: Proteins are biomolecules that play a variety of functions, including structural support, as…
Q: Explain briefly why the derivation of protein substitution matrices introduces a form of circular…
A: Introduction Proteins are large biomolecules and macromolecules that are made up of one or more long…
Q: A scientist wants to use a technique that allows to shuffle protein domains. Protein A and Protein B…
A: Ans: Protein domain: The protein carries separate region in the polypeptide protein which shows…
Q: How many human proteins are in the range of 250,000 to 900,000 Daltons?
A: The human body is thought to have over a million different types of protein, and even a single-cell…
Q: Define the process of Identification of protein domains ?
A: The protein regions that can evolve, fold, and function often independently of the rest of the…
Q: What is the most consistently (i.e. found in every case) energetically unfavorable aspect of protein…
A: People have developed molecular dynamics simulations of the basic atomic forces that determine a…
Q: Describe the typical principles used to identify topogenic sequences within proteins and how these…
A: Topogenic sequence is the peptide sequence by which protein insertion, orientation in membrane and…
Q: How do scientists make the migration rates of proteins reflect their molecular weights (sizes) and…
A: In electrophoresis migration is dependent on the size. Smaller fragments migrate faster than larger…
Q: What are the Characteristics Binding Site?
A: Binding sites are present in all the macromolecules such as proteins. This binding is done with…
Q: How can sequence comparisons reveal which amino acid residues are essential for a protein’s…
A: The amino acid joined together through peptide bond is known as primary structure of protein.…
Q: What (3) conditions are carefully controlled to minimize modifications in the structure of proteins,…
A: Three main factors to control are pH, Temperature and Salt concentration pH: Proteins are least…
Q: What are pentoses? What are the roles of pentoses in DNA and RNA molecules?
A: Pentoses - group of five
Q: What is meant by denaturation of proteins? Give examples of protein denaturating agent?
A: Proteins are composed of amino acids attached together in a linear chain of via peptide bonds.…
Q: What are two ways to denature a protein and why do these methods work?
A: Given: Two ways to denature a protein.
Q: Describe the problems associated with using a polypeptide’sprimary sequence to determine its final…
A: A polypeptide is a straight natural polymer comprising of countless amino-acid deposits fortified…
Q: Why can one not reliably predict the sequence of nucleotides onmRNA or DNA by observing the amino…
A: The amino acids on a protein are coded for by codons on the mRNA, which in turn was transcribed from…
Q: What is an open reading frame (ORF)? What is a hypotheticalprotein?
A: A Gene is a unit of heredity containing the fundamental information of life as a distinct sequence…
Q: What is the difference between an autonomous and a nonautonomoustransposable element? Is it possible…
A: Transposable elements (TEs) are the sequences of DNA (Deoxyribonucleic acid) that can move from a…
Q: What is the Rf value of each amino acid observed?
A: Rf ( retardation factor):- It is defined as the ratio of distance traveled by the centre of a spot (…
Q: Intrinsically disordered regions of proteins can be identified using bioinformatic methods to search…
A: Despite the classical structure-function paradigm (which is often visualized because the…
Q: A. What change should disrupt the interaction between proteins 1 and 2 the most? Why? B. What…
A: Introduction: Proteins are the polymers of L-α-amino acids. Proteins plays an important role in the…
Q: When answering the questions below, please use the one-letter code for the amino acid, with NO…
A: Protein sequencing is the process of determination of amino acid sequence in a protein. During the…
Q: Describe the planar sections of the primary sequence, their influence on the shape of the protein…
A: Amino acids are the building blocks of proteins. These are compounds containing Carbon, Hydrogen,…
Q: What is the function of the molecular chaperone? What would happen to the protein if molecular…
A: According to the question we have to give the function of the molecular chaperon. In addition to…
Q: About
A: Protein synthesis is important for performing various functions in the body. Synthesis of protein…
Q: How can widely separated parts of a protein interact with the spike protein
A: Spike proteins are glycoproteins that are present on the surfaces of the enveloped viruses of many…
Q: What contributes to the asymmetric protein distributions ?
A: The lipid bilayer (or phospholipid bilayer) is a thin polar membrane made of two layers of lipid…
Q: What are the various techniques in Molecular Biology used for the Isolation, purification, and…
A: Introduction Proteins:- A protein is an extremely complex natural substance made up of amino acid…
Q: does it mean for a protein to be denatured
A: Protein denatured means the activity of protein has been changed or stop by changing in protein…
Q: What are the four types of protein modification and their descriptions
A: Introduction Proteins Are Necessary Nutrients For Human Health. They Are A Component Of Body Tissue…
Q: what are the factors that can denature proteins ?
A: Asked : Factors that can denature proteins
Q: Can you describe the ensemble allostery model and explain how it is used to explain allostery in…
A: In allosteric regulation binding of a ligand to one of the subunit enhances or decreases the binding…
Q: how can you determine if a protein sequence is functional?
A: Introduction:Two main stages are there at which gene is expressed: transcription and translation.…
Q: Which technique is used to sequence peptides ?
A: Peptides are small sequence of amino acids. Each peptide has an amino terminal (N) and carboxyl (C)…
What are “forcefields” and how are they used in predicting how a protein sequence will fold?
Step by step
Solved in 2 steps
- What is the function of the molecular chaperone? What would happen to the protein if molecular machine does not work?Can you describe the ensemble allostery model and explain how it is used to explain allostery in intrinsically disordered proteins?(a) How many activation cycles are needed for a protein with 150 amino acids? (b) How many initiation cycles are needed for a protein with 150 amino acids? (c) How many elongation cycles are needed for a protein with 150 amino acids? (d) How many termination cycles are needed for a protein with 150 amino acids?
- Which is the major force responsible for the formation of an α-helix in protein secondary structure?What is meant by denaturation of proteins? Give examples of protein denaturating agent?What is the purpose of a protein ‘sorting signal’? What are some examples of common sorting signals and their corresponding destinations?
- Can Hydrophobic Interaction Bead Chromatography be used to isolate Protein X from muscle tissue if Protein X contains many hydrophobic regions? Explain the process of how to isolate Protein X from muscle tissue.Explain briefly why the derivation of protein substitution matrices introduces a form of circular reasoning linked to the 'alignment paradox'What is the expected molecular weight of the protein encoded by the sequence provided here: ATGGCGCACGCTGGGAGAACAGGGTACGATAACCGGGAGATAGTGATGAAGTACATCCATTATAAGCTGTCGCAGAGGGGCTACGAGTGGGATGCGGGAGATGTGGGCGCCGCGCCCCCGGGGGCCGCCCCCGCACCGGGCATCTTCTCCTCCCAGCCCGGGCACACGCCCCATCCAGCCGCATCCCGGGACCCGGTCGCCAGGACCTCGCCGCTGCAGACCCCGGCTGCCCCCGGCGCCGCCGCGGGGCCTGCGCTCAGCCCGGTGCCACCTGTGGTCCACCTGACCCTCCGCCAGGCCGGCGACGACTTCTCCCGCCGCTACCGCCGCGACTTCGCCGAGATGTCCAGCCAGCTGCACCTGACGCCCTTCACCGCGCGGGGACGCTTTGCCACGGTGGTGGAGGAGCTCTTCAGGGACGGGGTGAACTGGGGGAGGATTGTGGCCTTCTTTGAGTTCGGTGGGGTCATGTGTGTGGAGAGCGTCAACCGGGAGATGTCGCCCCTGGTGGACAACATCGCCCTGTGGATGACTGAGTACCTGAACCGGCACCTGCACACCTGGATCCAGGATAACGGAGGCTGGGTAGGTGCACTTGGTGATGTGAGTCTGGGCTGA
- Refer to Problems 26.62 and 26.63. What dipeptide is synthesized from the informational DNA sequence T-A-C-C-C-T?What are two ways to denature a protein and why do these methods work?What is the concept of FoldIt protein folding game, and how is it used to elucidate and visualize protein structures?