Q: Plant thermogenesis occurs when the inner membrane of chloroplasts have more thylakoids and stop…
A: The interior layer of membranes of chloroplasts, known as thylakoids, provide a foundation for the…
Q: A virion contains DNA and RNA. Viruses are acellular. Viruses replicate outside of the cell.
A: Introduction viruses are Infectious agents that produce diseases in all life forms such as in animal…
Q: How do virus infection and chemicals may cause cancer? Give examples and mechanisms
A: Introduction : Cancer is brought on by the uncontrolled division of abnormal cells in a body…
Q: Tick all the essential steps to demonstrate a genetic linkage between a disease and a molecular…
A: Genetic linkage is the tendency of certain genes to be inherited together due to their location on…
Q: Name the three major assumptions made by the "Cell theory". (i) The lipid membrane is composed of…
A: Cell theory is a scientific theory that states that all living organisms are composed of cells,…
Q: List two preparations shown every month by the uterus in anticipation of pregnancy in humans.
A: Introduction: Uterus Also called womb is an important organ of female reproductive system.its main…
Q: The following data shows bisulfite sequencing results for a small region of the genome. How many…
A: The process by which the methyl groups are added to the DNA is called the DNA methylation.…
Q: How to measure the muscle strength and muscle mass by using the anthropometric assessment
A: Anthropometric measurements provides the quantitative measurements of the body. This assess the…
Q: Use the following information to answer the next question. Small Segment of DNA Uracil Adenine 2…
A: DNA and RNA are the nucleic acid.The monomers of nucleic acid is the nucleotides.Nucleotide is…
Q: which of the following is a source of possible bias against minoritized people in genome wide…
A: For GWAS, thousands of people are required because the majority of genetic effects found for…
Q: 5 Multiple Choice Provided below is a dichotomous key for determining the kingdom of an organism. 1a…
A: Answer : a unicellular organism that lives in pond and lacks nucleus would be classified as a member…
Q: Which of the following hypothetical islands would likely have the greatest species richness?
A: Biodiversity, often known as biological diversity, refers to the variety of life that can be found…
Q: the evolution of complex animals is associated with the Annelids ( Earth worm), the mollusk (clam),…
A: Introduction Protostomes , Deuterostomes ,Cnideria and Proifera are different organism categories…
Q: Maple syrup urine disease may be due to an autosomal recessive mutation. Data indicate that the…
A: Given that, Maple syrup urine disease is autosomal recessive. The prevalence of this disease is…
Q: How do various criteria influence the choice of a given testing instrument? When choosing an…
A: Introduction:- Instruments are used to perform various tests, practicals and experimentations in…
Q: The team would now like to establish the smallest possible deletion that would inactivate the…
A: Amino acid monomers form the building blocks of proteins. The arrangement of amino acids makes up a…
Q: In classical Mendelian genetics, how can one check the genotype of a parent (A) expressing the…
A: Allele can be defined as an alternative form of gene.Dominant allele is an allele which hides the…
Q: A peptide has the sequence sequences in the coding strand of the DNA could code for this peptide?…
A: Genes are hereditary structure which helps in transfer of genetic information. It is important for…
Q: Predict what might happen if plants were able to absorb more carbon dioxide. How will this affect…
A: The current level of carbon dioxide concentration in atmosphere (0.03%) is suboptimal for the C3…
Q: WHEN do you think apoptosis occurs in humans? - What would be the effect if apoptosis doesn't…
A: ANSWER) Apoptosis is described as the natural programmed cell death occuring in the multicellular…
Q: what technique was used to figure out if some Tasmanian devils would be more likely to survive the…
A: A condition known as cancer occurs when some body cells grow out of control. Since the human body…
Q: do strawberry and raspberry fall under the category of eudicots
A: The eudicots, also known as eudicotyledons, are a group of flowering plants that are primarily…
Q: Adherence to the intestinal lining by a bacterium may be due to its possession of _____. A)…
A: Bacteria are tiny, single-celled organisms that thrive in complicated habitats. These species will…
Q: Based on the change to the nucleóti How did this mutation change the amino acid sequence of the…
A: A mutation is the term that describes change seen in the sequence of nucleotides that may…
Q: Summarize the evidence regarding the sum of evolutionariy modifications from the given putative…
A: Evolution is the gradual change in the inherited traits of biological populations over many…
Q: List all steps involved in a cloning workflow. Name and link the appropriate enzymes to the steps at…
A: Gene cloning involves the following basic 7 steps: Obtaining DNA fragments from the target gene…
Q: http://www.treeboss.net/tree-trunk-splotches.htm downloaded 21 March 2012 Q12. What do you think it…
A: This activity is about different types of living beings which have different characteristics such as…
Q: Normally, the [Select] of our brain is primarily in control of our minds. This is where rational…
A: The frontal lobe, the largest part of the brain, controls personality traits, decision making and…
Q: How do you differentiate a nodule from a root gall?
A: Abnormal outgrowths of plant tissues and can be caused by nematodes is gall and nodule is formad by…
Q: When a neurotransmitter-filled vesicle is in the primed position, which t-SNARE connect is critical…
A: Synapses are structures or junctions that facilitate the passing of an electrical or a chemical…
Q: 1 agagtctcct cagacgccga gatgctggtc atggcgcccc gaaccgtcct cctgctqctc 61 tcggcggccc tggccctgac…
A:
Q: An allergy can best be defined as ______. A) a component of the humoral response B) an exaggerated…
A: The function of the immune system is to protect from foreign substances. Hypersensitivity is a…
Q: STR markers: are point mutations detectable by DNA sequencing are variations in the number of…
A: STR markers, also known as short tandem repeat markers, are regions of DNA that contain a pattern of…
Q: Suppose that a consensus sequence in the regulatory promotor of a eukaryotic gene that encodes an…
A: Gene transcription i.e., mRNA formation from the DNA required many transcription factors and RNA…
Q: 1 agagtctcct cagacgccga gatgctggtc atggcgcccc gaaccgtcct cctgctgctc 61 tcggcggccc tggccctgac…
A: Annotating a genome involves finding functional components throughout its sequence in order to give…
Q: Your short answer should be 2-5 sentences depending on the question. (Ch. 55). Please answer both…
A: Most ecosystems have only 3 or 4 trophic levels. Some believe that humans should consume plants…
Q: Use the following information to answer the next question. A Venn Diagram Showing the Relationship…
A: All the hereditary information is passed from one generation to another via genetic combinations.…
Q: There are various types of connective tissue. Explain how differences in this tissue type aid in…
A: Connective tissue is found in between other tissues and is present everywhere in the body, including…
Q: Based on the data shown in the pie charts (from DiFilippo et al. 2010): Gut microbiome richness is…
A: Species diversity is the variety of species found within a region. Species diversity has two…
Q: termini). What type of mutation is each? 6.a. Mutated DNA Template Strand #1: 3'-TACTGTC TGACGAT…
A: DNA It is a double helix structure that constitutes two polynucleotide chains wound around each…
Q: .What is biomass as a source of energy? Is it considered as renewable source of energy?
A: Biomass energy is the energy which is generated by using living mass. Biomass is a renewable energy…
Q: Describe the methods you could have used to isolate the pathogenic organism from the initial stool…
A: A non-pathogenic organism is an organism that does not cause disease. Examples of non-pathogenic…
Q: Describe the body’s natural defenses in each of the body systems. Identify the role played by the…
A: The human body has its natural defenses which protect the body from various barriers and external…
Q: Which of the following is NOT considered a secondary messenger? A. diacylglycerol B. inositol…
A: After a signal molecule binds to the cell receptor, a sequence of conformational changes occurs, and…
Q: Choose the letter that best matches the statement each. Answers may be used more than once or not at…
A: The correct answer to each statement is: Water permeability of this region of the nephron is highly…
Q: which is the following is not a step in the process of de novo gene birth? o translated peptides…
A: The method through which new genes arise from DNA sequences which weren't previously genic is known…
Q: Connective tissue comes in a variety of types. Explain how variations in this tissue type help to…
A: Connective tissue is widely distributed as well as one of most abundant tissue in our body. It is…
Q: What is the correct order of processes for how a message is integrated in your sensory systems?…
A: The sensation is the activation of sensory receptors as well as the central nervous system to allow…
Q: Please explain whether CAR T-cells alter tumor cells expressing gasdermin -B, -E and -D when anti-…
A: Gasdermin is protein in humans, implicated in human response. It comprises six types in human, that…
Q: DNA is alway DNA mRNA 5' aal 3 51 PROMOTER AACGCATACGGGATAGCGCCCTGGTTCAAATGGCGGGCCGGCATCCC…
A: One of the core concepts of molecular biology is the flow of information from DNA to RNA to…
What are "genetic biohackers" in reference to "do it yourself CRISPR kits"?
Step by step
Solved in 2 steps
- What would be some major impediments to genetically modifyinghuman embryos with CRISPR?What is the function of the CRISPR/Cas system? What are the ethical impacts of a technology such as CRISPR?What is the role of streptomycin in CRISPR experiment? What biochemical changes (DNA, protein) occurred in those cells in which CRISPR worked?