What blood vessel that carries oxygen poor/deoxygenated blood from the  heart to the lungs?         a. Pulmonary Artery       b. Pulmonary Veins       c. Superior Vena Cava

Q: Why is glucose provided by glycogenolysis in the liver but not in skeletal muscle?

A: Through glycogenolysis process, glycogen broken down into glucose and provide energy.  Muscle…

Q: Identify three cells. Each cell should be in a different stage of mitosis. For each cell, annotate…

A: Cell cycle is divided into two phases -  1. Interphase 2. M-phase (mitotic phase) In the interphase…

Q: To explain: Why do seedlings that germinate in a fully darkened room grow taller than seedlings of…

A: Every living thing is hardwired to thrive in its own environment. Nonetheless, they require a number…

Q: To explain: The way in which the shortened telomeres affect the life-span of IPSCS and…

A: Stem cells are an undifferentiated mass of cells that can differentiate into specific cell types.…

Q: Which of the following is correct about the differences between DNA and RNA? DNA is usually…

A: INTRODUCTION DNA : Deoxyribonucleic acid RNA : Ribonucleic acid

Q: 8. DNA basic structure: Below, I have drawn a representation of a single strand of DNA. Draw a…

A: The self replicating molecules that are present in the chromosomes and carry genetic information are…

Q: Learning Task 13-1: Diseases Caused by Mutations Disease What gene is affected by Mutation? What is…

A: A genetic disorder is a medical condition caused by one or more genetic defects. A chromosomal…

Q: Explain the formation of tree rings.

A: Introduction :- A tree's girth grows each year, and the new growth is known as a tree ring. The…

Q: س 1/ 1 درجة the percentage of lymphocyte is-4 .A 20% .B 30% .c 10% .D 50% بأختيار الاجابة الصحيحة س…

A: Lymphocyte- it is a type of white blood cell in the immune system of most vertebrates is known as…

Q: STRUCTURE STAINING IMPORTANT EVENTS OF DEVELOPMENT Proerythroblast Basophilic erythroblast…

A: There are few important points : Blood is a connective tissue composed of liquid extracellular…

Q: When DNA is copied, sometimes a mutation occurs where an incorrect, base pairing appears within the…

A: Introduction :- Two nitrogen-containing bases (or nucleotides) that join to form the DNA structure.…

Q: Set 3: Mutagens 51) breaks the sugar-phosphate backbone of DNA A) ultraviolet light 52) cause…

A: Given: Anything that cause changes in the DNA of the cell is known as mutagens. DNA are the…

Q: The formation of _ is a positive result in the VDRL test. Group of answer choices cytopathic effect…

A: Laboratory tests to detect antibodies and antigens outside of the body (e.g., in a test tube) are…

Q: QUESTION 50 Expression of the maternal vs paternal alleles for the Igf2 gene is determined by: O…

A: 50. Expression of the maternal vs paternal allele for the Igf2 gene is determine byimprinting…

Q: 9. Most species of Clostridium, which are widely distributed in the environment, are harmless to…

A: Infection is the entrance of pathogens into an organism's bodily tissues, their growth, and the host…

Q: (a) Distinguish between micelles, liposomes, bilayers, vesicles, and membranes. (b) Discuss the role…

A: Ans a- Liposomes are composed of a lipid bilayer separating an aqueous internal compartment from the…

Q: Make a situation on how an organism (plant/animal) maintains homeostasis.

A: Homeostasis It is defined as the ability of the organism to maintain a constant and stable internal…

Q: When there is light, plants release oxygen. What else may plants also use oxygen in? photosynthesis…

A: Plants release oxygen from photosynthesis. Photosynthesis is a process in which green plants prepare…

Q: The shape of a DNA molecule is most like O A) the letter X. O B) a diamond ring. C) a set of…

A: The traits that an individual exhibit is the result of the genetic material that they inherited from…

Q: Assume that we want to minimize a function using evolutionary algorithm. For our coding process, we…

A: Let us assume number of slots in roulette is 38  Where C1 occur 5 times  Therefore getting C1 =…

Q: Proteins/peptides exclusively expressed by tumor cells are termed as                  a. tumor…

A: Cancers are caused by mutations in the gene sequence of the tumor suppressor gene or protooncogene…

Q: Body organisation in Hydra is of- (A) Tissue grade (B) Organ grade (C) Cellular grade (D) Organ…

A: Hydra: Hydra is a phylum Cnidaria and class Hydrozoa genus of microscopic freshwater creatures. They…

Q: Although this group has the least number of identified and classified species, its diversity is…

A: Animals are diverse and are classified based on their shape, size, morphology, eating habits, and…

Q: The cortical nephron is characterized by all of the following except:   a. short nephron loop…

A: Kidneys- they are a pair of organs that belong to the urinary/excretory system. They are bean-shaped…

Q: Scientists at the Global Footprint Network calculate the energycomponent of our ecological footprint…

A: Ecological foot print measures the utilization of natural resources.Ecological foot print depends on…

Q: Match each item with the correct statement below.         Nonpharmacologic methods to manage…

A: Introduction :- Both Crohn's disease and ulcerative colitis are inflammatory bowel diseases. Crohn's…

Q: A single base addition and a single base deletion approximately 15 bases apart in the mRNA…

A: Introduction DNA:- is the hereditary material of an organism. The gene comprises the DNA. The…

Q: phenotypic screens.

A: Phenotype: Any measurable characteristic or distinctive trait possessed by an organism is called The…

Q: To explain: The reason for careful attention being given to the diet of infants; especially…

A: The brain is the part of the body in charge of controlling its overall functions. It governs all of…

Q: What are the current concerns with the rate of global meat consumption

A: Consumption of meat and meat products means an important source of nutrients  proteins, iron and…

Q: Which of the following options best depicts the flow of information when a gene directs the…

A: The journey from a gene to a cellular component (proteins) is a complex process and is strictly…

Q: Describe the structure of the Lac operon. How is it turned on? How is it turned off?

A: The gene products of the lac operon are very important for lactose metabolism. This is crucial for…

Q: Cellular slime molds (a) include Physarum and Phytophthora (b) are more closely related to bacteria…

A: Protists are the unicellular eukaryotes that vary in size and mode of nutrition.

Q: A review of the phylogenetic tree shows a common ancestor for these vertebrates. Which statement…

A: Phylogenetic tree of vertebrates showing common ancestor.

Q: sketch the microscopic features of the genus asperigillus

A: Introduction :- A fungus is any member of a group of eukaryotic organisms that includes…

Q: In ecological systems, a rough rule of thumb is that when energyis transferred from plants to…

A: Energy transfer from one organism to another organism in an ecosystem occurs through the food chain.…

Q: Leech obtains continuous blood flow from its victim by pouring in it- (A) Heparin (B) Hirudin (C)…

A: Introduction - Leeches are parasitic or predatory worms with segmented bodies that belong to the…

Q: Why do anisogamous organisms only experience the twofold cost of sex?

A: Isogamous sexual reproduction occurs when male and female gametes have similar morphology. They are…

Q: Identify a passive tissue that could be exposed to continued plastic stress (deformation). Explain…

A: Passive tissue is those that undergo stretching when they are not even stimulated and hence…

Q: he ability to multiplex the PCR reactions used in STR analysis (many PCR amplifications occurring in…

A: Dr.Kary Mullis invented the polymerase chain reaction (PCR) in 1983. The enzyme used in this…

Q: In a well-publicized paternity case, the following facts were determined: the mother, a beautiful,…

A: Child is type O and mother is type A than father should be :-

Q: Section E. The Secondary Tissues of Roots in Woody Dicots Identify and label these parts in old…

A: All the flowering plants can be either monocots or dicots. Dicots or eudicots are plants that…

Q: b) Use the DNA sequence below to answer the following questions. 3'- TACGAACGAGTGCCCCAAAATT -5' What…

A: The process of converting DNA instructions into proteins is known as the central Dogma.

Q: During a mild exercise, which one(s) will NOT increase? 1. MAP 2. Systolic arterial pressure 3.…

A: Exercise improves the efficiency of the cardiovascular system by delivering oxygen and nutrients to…

Q: Mathis Wackernagel and his colleagues at the Global FootprintNetwork continue to refine the method…

A: Based on the average income per person, countries have been classified as developed or less…

Q: Strain X. spp. is a rod-shaped, anaerobic, Gram-positive bacterium with peritrichous flagella and…

A: Doubling time is the time required by a cell, in this case the bacterial cell, to divide and produce…

Q: When the inspiratory neurons of the ventral respiratory group are actvated, impulses travel along…

A: The diaphragm contracts and deflates upon inhalation, while the chest cavity expands. A vacuum is…

Q: What is the function of DNA helicase in DNA replication? to create an RNA primer to initiate DNA…

A: DNA polymerase plays a key role in new DNA synthesis.  In eukaryotes, DNA polymerases can be…

Q: Which of the following is not true of the protists? (a) they are unicellular, colonial, coenocytic,…

A: Any unicellular or multicellular creature which is not a mammal, plant, or fungus is referred to as…

Q: What is the difference between the heart sounds of lupp and dupp?

A: Lub and dup are cardiac sounds that can be detected with a stethoscope placed on the chest just…

Nutrition and diet

We are involved in several daily activities. These actions need a significant quantity of energy. The food we eat provides this energy. Food is necessary for development, repair, and other living activities since it supplies energy. All of these are part of the living practice known as nutrition. Nutrition is the study of nutrients in food, how the body uses them, and the relationship between diet, health, and disease. Nutritionists employ concepts from molecular biology, biochemistry, and genetics to understand how nutrients affect the human body. Nutrition also looks at how people can use their diet to reduce their risk of disease, as well as what happens when they ingest too much or too little of a nutrient and how allergies emerge.