What is born Cancer

Q: Question: Explain how being mortal might be protection from cancer.

A: Cancer is also known as a malignancy that depicts the abnormal growth of cells. Cancer is a disease…

Q: what causes Organellar Inheritance

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: knowledge about biochemistry

A: Definition- Biochemistry is the branch of science that deals with the study of chemical processes in…

Q: How is cancer related to cell division (simple explanation)

A: Cancer is an abnormal condition that arises due to uncontrolled cell division and proliferation.…

Q: What causes cancer?

A: A collection of related diseases is called “cancer”. This occurs due to the uncontrollable growth of…

Q: Mutations

A: With the improvement in technology, humans are now able to alter the basic features of an organism…

Q: Why Don’t Elephants Get Cancer?

A: Cancer or cancer cells are the cells that have lost the capability to follow the normal control.…

Q: Why if cancer occurs in any part of the body, it is difficult to grow in the spleen, muscle, small…

A: Cancer cells are the type of cells that loses their control over growth and form lumps of cells…

Q: how does radiation for breast cancer relate to the cell cycle and mitosis

A: One of the ways implemented for the treatment of breast cancer involves radiation therapy. In this…

Q: Mitosis: Events

A: During mitosis, a cell duplicates all of its contents, including its chromosomes, and splits to form…

Q: What is happening in all cancer? What process is this disrupting?

A: Cancer in simple term can be referred to a set of diseases which are caused by the production of an…

Q: 1.) Download an article related to on how Cancer Develops, how cancer affects cell cycle.

A: Genetic changes In normal cells, genes regulate growth, maturity and death of the cells. Genetic…

Q: What stage cancer did the football player alfonso have?

A: Cancer is the uncontrolled division of cells. It has four stages. Some cancers have zero stage too.…

Q: Did Steve Job's cancer metastasize during the nine months he tried holistic treatments rather than…

A: Steve Job,the co-founder of Apple Inc.,had discovered cancer in pancreas during a CT scan in…

Q: Is cancer a genetic disease ?

A: Cancer includes overgrowth of the cells above the normal number. It is studied under the domain of…

Q: Which process or processes prevents UV radiation from causing cancer? A. MMR B. NHEJ C. HDR O D.…

A: UV radiation is a type of non-ionizing radiation emitted by the sun and man-made sources such as…

Q: What is cancer?

A: In a multicellular creature, cell division is a natural process. Cell division has usually defined…

Q: Why are sa

A:

Q: what means the development of cancer

A: Cell division in human is a highly organized process that strictly follows both the stimulation and…

Q: Mitosis

A: Mitosis is an equational division that leads to the production of genetically identical cells.

Q: Explain the difference between mutation and DNA damage.

A: DNA is deoxyribonucleic acid. It is the genetic material and is responsible for carrying genetic…

Q: How do cancers protect themselves from cell death?

A: Introduction :- A multicellular organism's life cycle must include cell death. Most cell deaths…

Q: How Cancer Involves the Proliferation of a Clone of Cells?

A: When the cell division becomes out of control and cells starts accumulating it results in cancer.

Q: What is brine

A: a homogeneous combination of two or more substances in relative proportions that can be changed…

Q: What does the cancer stage refer to

A: A cancer's stage explains the size of the primary tumour and how far the cancer has spread across…

Q: Who discovered nucleus

A: Introduction The nucleus is a large membrane-bound organelle that contains genetic information in…

Q: True or False: When cell division gets out of control in a cell, metastasis can spread the cancer to…

A: Cell division is a process by which a cell divides into two or four daughter cells. The cell…

Q: Body Covering: DNA: GGGAGTGTATACGGGATGAAGGCGATT MRNA: 12 protein: phenotype:

A: To make proteins transcription happen, which mean DNA(genes)>copy of gene>protein, this is the…

Q: Loss of heterozygosity of tumor suppressor gene_______________

A: Loss of heterozygosity -It is the loss of one parent's contribution to cell and can be caused by…

Q: the process in which one cell divides to form two daughter cells

A: Cell division is a process by which parent cell is divided into one or more cells. Cell division is…

Q: Inferior to the umbilical region

A: Human Anatomy is often defined as the study of structures in the human body. Anatomy focuses on the…

Q: tired than usual and has developed bruising and petechiae on his extremities and trunk. Jack and his…

A: Leukemia can be defined as a group of medical malignant disorders, affecting the blood, bone, bone…

Q: What is the relationship between the cell cycle and cancer production?

A: A cell is the fundamental, structural, and functional unit of the living cell bounded with a cell…

Q: Explain how a missed cell cycle checkpoint results in cancer. (in 5 sentences)

A: Answer. The cell cycle is a highly regulated and dependent series of events, mediated by a number of…

Q: What is medical coding

A: Nurses are accountable for ensuring that client care documentation is correct, timely, and…

Q: stages of mitosis

A: Mitosis is a process of cell division in which one cell give rise to two identical daughter cells…

Q: A DNA

A: DNA acts as the genetic material in most of the organisms . DNA stands for the deoxyribonucleic…

Q: What are the answers to the questions

A: Question 8 :  Answer is dichotomous key which is most commonly used in floras and manuals especially…

Q: Describe the effects on a cell if a mutation were to cause a faulty proto-oncogene or a faulty tumor…

A: DNA is the main hereditary molecule of the cell. DNA contains genes that code for RNA and proteins.…

Q: stem cell research,

A: Stem cells are undifferentiated cells which has ability to differentiate into specialized cells.…

Q: Cancer considered as Cell Cycle Disease?

A:

Q: Genetics

A: A branch of biology that deals with heredity and variation of organisms is called genetics. Mendel…

Q: To determine: The errors in the cell cycle that affect humans by causing cancer.

A: Mitosis is a cell cycle, equational division. Mitosis occurs when a somatic cell divides into two…

Q: How a reciprocal translocation helps causeone kind of leukemia

A: Translocation is an exchange of chromosomal segments between the non-homologous chromosomes.  It is…

Q: What effects does cancer have on the body?

A: All living organisms have cells, which are the most basic and crucial unit of life. All of the…

Q: mutation

A: Genes encode proteins and proteins dictate cell function. Mutation creates slightly different…