Q: PROBLEM The following data were obtained from the thyroid uptake study of a patient after administra...
A: thyroid uptake is the method via which the radiologist determines the thyroid function in the patien...
Q: What is genetic disorders? Explain by giving an example.
A: Genetics is described as the branch of biology that focuses on the study of genes, their inheritance...
Q: While investigating the function of a specific growth factor receptor gene from humans, researchers ...
A: Growth factors work by engaging with certain cell surface receptors to control cellular proliferatio...
Q: An epitope associates with which part of an antigen receptor?
A:
Q: What types of molecules pass easily through the plasma membrane?
A: Plasma membrane plays important role in cell function and in the life process of living organisms. I...
Q: 4. (1) How many females and males are affected in this pedigree? (2) Who is the proband? II (3) How ...
A: NOTE-"As per our honor code, we are authorized to answer only one question at a moment. As you have ...
Q: mutation on HIV replicatication
A: Human immunodeficiency virus = HIV
Q: Elaborate thoroughly: What insects are expected to have the most sclerotized heads? Explain. Does a...
A: INTRODUCTION Insect morphology is an physical form of insects is used to obtain many type...
Q: How has having an opposable thumb helped primates, especially humans, adapt to their environment and...
A: The opposable thumb is an adaptation that helps humans and other primates to carry out the tasks the...
Q: What is genetic disorders? Explain by giving an example.
A: Genetics is described as the branch of biology that focuses on the study of genes, their inheritance...
Q: All of the following are true about lipids except A. They store more energy than carbohydrates ...
A: Lipids are a type of macromolecule that contain hydrocarbon. Fats, wax, oil are few examples of lipi...
Q: Please answer fast Briefly describe the pathways the body can use to make each of the Big Four clas...
A: The 4 classes of macromolecules are - carbohydrate Lipid Protein Nucleic acid Carbohydrate pr...
Q: Energy is added products This graph shows an reaction. AG >0 reactants Time Gibbs Free Energy
A: *Endothermic reaction: An endothermic reaction is chemical reaction that absorbs heat from its en...
Q: Please answer fast The phenotypes of organisms are products of genetics, environment, and gene x en...
A: Phenotype: it represent the physical properties of organism that can be observed. Phenotype includes...
Q: 5. Construct a gene map given the following information Which two genes are most likely going to be ...
A: Genes are present in the cells of an organisms. Cells are the basic units of the organism that const...
Q: For the following Chi-square table, how many degrees of freedom should be used when calculating the ...
A: Introduction: The chi-square degrees of freedom are determined using the formula df = (r-1)(c-1), w...
Q: Select all the statements that provide evidence that DNA is the genetic material. Check All That App...
A: The eukaryote chromosome is linear and contains both DNA and protein, and both are found in equal ma...
Q: How are physiological insect defensive mechanisms carried out by the insect circulatory system? Does...
A: Insects have a closed circulatory system.this means that in the body; blood is not circulated throu...
Q: A metabolic pathway_____ . a. may build or break down molecules b. generates heat c. can include red...
A: A metabolic pathway is a set of chemical events seen in biological processes that aid in the convers...
Q: Cellular Respiration and Fe concept map. Most of the terms have been removed from the con sed on the...
A: On investment of 2 ATP and 2 NAD+ it produces - Pyruvate It produces 2 NADH and 4 ATP If no oxygen...
Q: You discover a species in which most individuals display a diploid number of 28. However, you alsa n...
A: Haploid is the condition in which a cell has a single set of chromosomes. Triploid is the condition...
Q: What is the purpose of an autoclave and what is its mechanism?
A: Answer :- An autoclave is utilized in clinical and research facility settings to disinfect lab hardw...
Q: "Dietary restriction has been shown to have several health benefits including increased insulin sens...
A: The conventional method of dietary control was believed to be dietary restriction of caloric intake....
Q: Making your D.I.Y Herbarium. 1.) How do MRI’s work
A: Herbarium simply consists of dried plant species mounted on a peice of paper. These plant species ar...
Q: he following data were obtained from the thyroid uptake study of a patient after administration of I...
A: According to the data provided, the percentage of thyroid uptake of the patient after administration...
Q: Explain the relationship between turgor and osmotic pressure
A: Turgor pressure allows the osmotic entry of water through a semipermeable membrane into a cell. This...
Q: Researchers studying the bacterium Escherichia coli split a population of the bacteria into two samp...
A: The claim best supported by the data in table 1 is: D. Only the bacteria that were successfully tran...
Q: Translate this RNA transcript: 5' - UUUCUUAUGUGUCGCCGUAAUUGAUAUUAC - 3'. O Phe-Leu-Met-Cys-Arg-Arg-I...
A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: Tra...
Q: Look for an ecosystem in local setting which shows an inverted pyramid. Is this possible in an ecosy...
A: Yes, inverted pyramid is possible in ecosystem. There are many examples like pyramid of biomass in a...
Q: Short answer. What uses do plant chemicals have to humans? Name two. 2. Short answer. Plants produce...
A: Since you've asked multiple, we are only answering the first three questions for you. If you want an...
Q: 10. Name two media used to isolate Staphylococcus from mixed flora specimens and one for use wit...
A: 10) ANSWER;- Mannitol salt agar medium is both differential and specific media for Staphylococcus au...
Q: _______is life’s primary source of energy. a. Food b. Water c. Sunlight d. ATP
A: Food is essential for humans and other animals because it provides the energy needed to perform ever...
Q: Explain the mechanism by which cells sample extracellular fluid.
A: Extracellular fluid refers to bodily fluid that is not contained within cells. It can be present in ...
Q: Flow cytometry analysis was performed on the blood of an individual known to have been recently expo...
A: Rhino virus: it causes common cold, pneumonia in children. Mycobacterium: it causes tuberculosis. I...
Q: What's the role of Protein Phosphatase 1 (PP1) in cell signaling?
A: Protein phosphatase 1 (PP1) belongs to the protein serine/threonine phosphatases family of phosphata...
Q: How many genetically different eggs could be formed by women with the following genotypes? a. Aa bb ...
A: Genetics is a branch of the biology involved in the study of genes, genetic variation, and heredity ...
Q: o you think multicellular fungi use diffusion, or use bulk flow, to transport O2 and CO2? Why do yo...
A: The microscopic organisms that eats organic material are sometimes refers as the fungi. These are r...
Q: What do you think would happen if you tried to view a slide using the oil immersion lens but forgot ...
A: Q. What do you think would happen if you tried to view a slide using the oil immersion lens but forg...
Q: Number of cycles 1 сycle Step Temperature Time Initial Denaturation 98°C 5 minutes Denaturation (a) ...
A: Polymerase Chain Reaction requires 5 most important aspects before starting with the protocol, these...
Q: he daughter can be considered an expert witness in a scenario like this because she has knowledge, e...
A: There are few point about expert witness: As we know that now a days expert witness are very importa...
Q: Who would you expect to have the most frequent sex and the most satisfying sex, hook-up couples or c...
A: Reproduction ensures the continuity of species on earth. But it is not necessary for survival. Throu...
Q: What does the Calvin-Benson cycle produce? What molecule is "fixed" in the reactions of the Calvin B...
A: Note :- Since you have asked multiple questions im only answering the ist 3 as per bartleby guidelin...
Q: 5. Construct a gene map given the following informa Which two genes are most likely going to be inhe...
A: The crossover frequency is a frequency that measures the rate at which crossing over takes place bet...
Q: Bacterium is gram positive, bacillus, single, short chain. How to determine the bacterium step by st...
A: **As per our guideline, we are supposed to answer only three sub-parts of a question. Please repost ...
Q: Name one environmental factor that typically influencesenzyme function
A: The rate of reaction of an enzyme was measured by the amount of substrate converted into a product. ...
Q: 1. In a three-point testcross, the nonrecombinant progeny are A* B* C* and a b c. The double- crosso...
A: Q. In a three-point testcross the nonrecombinant progeny are A+B+ C+ and a b c. The double crossover...
Q: ical reaction, the are converted to products. Select all that apply. reactants J enzymes O catalysts...
A: A chemical reaction is a process in which one or more substances called reactants are converted to o...
Q: 3. The following chart shows the crossover frequencies for some genes on an autosome of organism Z. ...
A: Linkage is the phenomenon in which two gene exist on the same chromosome . When genes exist on diffe...
Q: In the Pea plants studied by Gregor Mendel, green pod colour is dominant over yellow pod colour. You...
A: Dominant and recessive character - In genetics, dominance is the phenomenon of one variant (allele)...
Q: Which adipokine promotes inflammation and causes insulin resistance? A. Leptin B. Adiponectin ...
A: Adipokines are cytokines that are released from adipose tissue. These have been associated with cont...
What is done when there is a delay of stool examination?
Please answer in your own words, do not plagiarize. Thanks in advance!
Step by step
Solved in 2 steps
- In not more than 7 sentences, discuss briefly the techniques used in microscopic examination of stool. Long answers are very much appreciated. State your answer in your own words and do not plagiarize. Thanks in advance!Please answer and explain. Thank you! Compare and contrast direct fecal smears (DFS) and D' Antoni's Method for stool examinationPlease answer and explain. Thank you 1. List down 2 advantages and 2 disadvantages of wet mounts in stool examination
- Hello good day, I hope today has been kind to you. So I am having a problem answering this question and I need your help. Hoping for a response and thank you so much. Instruction: The answer must be in 2 paragraphs and each paragraph must have a minimum of 4 sentences. In addition, please indicate your source(s). Thank you so much. Question: What is the method of preparation in doing the procedure called wet smear sample?Refer to the image below and answer the following questions. A stool exam was done and the results were unremarkable. Which of the following is NOT part of the patient’s stool analysis results? A. Gmelin’s test revealed a change of color from green to red to yellow. B. The addition of benzidine in glacial acetic acid revealed a blue-green color. C. Macroscopic analysis revealed normal stool color and appearance. D. None of the above A FOBT was requested. Which of the following is FALSE regarding this exam? A. It is known as the Fecal Occult Blood Test which is able to detect the presence of blood in stool not seen by the naked eye. B. A negative result means complete absence of any gastrointestinal bleeding and its complications. C. The test is based on guiac which reveals a blue color in the presence of bleeding D. None of the above. If the patient’s stool was examined and revealed gross fresh blood on analysis,…The physician has ordered that a urine culture be taken on a client. Whatpriority information should the nurse know in order to complete thecollection of this specimen?a. Date and time of collection b. Method of collectionc. Whether the client is NPO (to have nothing by mouth)d. Age of client
- The nurse is preparing the patient for placement of an indwelling urinary catheter. Which statement has priority for the nurse to ask the patient? A “Do you have a preference of which leg the tube is taped to?” B “When did you last attempt to void” C “Do you feel the need to void” D “Are you allergic to iodine or Betadine”What are the protocols we consider before proceeding in doing the phlebotomy procedures?How you would perform embalming with the presence of a specific illness or disease of your choice. Please include: Background on the illness/disease, how it presents itself in the body, how it contributes or causes death, how you would embalm a person who had this illness/disease. This would involve any extra complications you will encounter, extra precautions you may need to take, specific fluids that would work best, etc. You may include examples that you have either witnessed, or do your own research.
- Please answer Among the tests in the Physical Examination of Urine, odor, color and clarity is there or are there test/s that are no longer being performed in today's setting? Why or why not.What are the tests performed in the laboratory for the determination of NPN compounds in blood? Discuss the use of the urea nitrogen/creatinine ratio to distinguish prerenal, renal, and postrenal causes of uremia. Kindly insert you references here. Thank you!Among the test in the Physical examination of the urine, is there or are there test that are no longer being performed in today's setting? why or why not?