What is the coordinate for this TSS? contigt:9,846-9,856 11 bp.potion or rch termScle5 basesdmapenecotigtROsolRAssFytase Genestra-traRATranscription Start Stes idertilied by modENCoDETSS re 165841SomosENCODE NA-Ses trom D. melanogaster Whole Adut FemalesAdut Females

Introduction: Transcription is the process by which the information in a strand of DNA is copied…

Answered: What is the coordinate for this TSS?

Science

Biology

What is the coordinate for this TSS?

Biology: The Unity and Diversity of Life (MindTap Course List)

15th Edition

ISBN:9781337408332

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter31: Animal Tissues And Organ Systems

Section: Chapter Questions

Problem 9SQ: Straps or dense, regular connective tissue _______. a. connect muscles to bones b. produce blood...

See similar textbooks

Related questions

Q: Give the following meaning of the diagnostic terms below: auscultation rhonchi - percussion sputum -...

A: Lung sound Lung sounds or breathing sounds or respiratory sounds are sound that produced during inh...

Q: If our DNA contains all the information about who we are, how can something that does not involve ch...

A: Deoxyribonucleic acid (DNA) is the genetic material of living organisms. DNA provides the instructio...

Q: What do you think would happen to the mouse population if the number of fox predators, such as wolve...

A: Nothing will happen according to the options available in the question.

Q: Write a short discussion based on the graph and calculate mean growth rate and mean generation time

A: "ANSWER Growth of bacteria curves for E. coli in LB ( Lysogeny broth ) media.The OD 600 , used to ...

Q: PeptiDream has developed a technology to create cyclic peptides. Which of the following is TRUE abou...

A: PeptiDream’s Peptide Discovery Platform System (PDPS) is a proprietary technology that allows drug r...

Q: At the cafeteria's eat-all-you-can salad bar, Ken was reading her histology book. Until her buddy dr...

A: Connective tissues are those tissues that support, connect and provide structure to other types of t...

Q: attached image...) Is this an image of a plant root or plant stem? Justify your answer. Is this ...

Q: Gyraulus convexiusculus is the first intermediate host of: * Echinostoma ilocanum O Fasciola hepatic...

A: Parasites are organisms that exist by feeding on other species, or hosts. Some parasites have littl...

Q: Which body part/s of a chicke have feather tracts and which part/s do not?

A: The organism(animals or birds) body is a very complex creature made up of several systems. Each syst...

Q: Expression of recombinant proteins in yeast is an important tool for biotechnology companies that pr...

A: The production of recombinant protein is very costly. For the process of development of any new prod...

Q: 5

A: Elements are the building blocks for all the rest of the matter in the world. A large fraction of th...

Q: Describe why fitness has a molecular basis. How does DNA play a role in an organism's fitness? Is DN...

A: DNA(deoxyribonucleic acid) is defined as the biological molecule that carries all the genetic inform...

Q: Explain how the phrase survival of the fittest differs from the biological definition of relative fi...

A: Natural selection: It is an evolutionary process by which living organisms adapt to their environmen...

Q: What are Chromosome territories ?

A: Chromosomes are condensed thread like structure found inside the nucleus of eukaryotic cells. It is ...

Q: Give examples of environmental factors that affect phenotype byaltering gene expression

A: Introduction Environment plays a major role in the diversification of organisms. For example, if we...

Q: Define the pre-mRNA & mRNA spliceforms of Intron retention ?

A: Pre-mRNA is defined as the first transcript that occurs from a gene that is protein coding in nature...

Q: Make a simple sketch of meiosis in a cell with a diploidchromosome number of 4. Now try it when the ...

A: The basic structural and functional units of heredity are genes. They are made up of deoxyribonuclei...

Q: 1. Give an example of parasitic plants and what structural adaptations are present in these plants t...

A: Balanophoraceae, Orobanchaceae, and Rafflesiaceae

Q: Indicate what type of survivorship curve this is and explain why.

A: Survivorship curves represent or depict the number of individuals in a population who are alive at d...

Q: A population of tribbles got on board two different starships and has been evolving apart for 6 mont...

A: ANSWER;-

Q: How did Griffith’s work provide a foundation for the experiments of Avery and his colleagues pointin...

A: Introduction In the past years when the genetic and molecular biology techniques were not so develo...

Q: membrane b.) outer membrane c.) thylakoid membrane d.) all of the above 2.) What is the maximum ...

A: Answers

Q: Describe the base-pair rule. - What three things make up a nucleotide? - What does anti-parallel mea...

A: 1.Base pair rule: This rule in DNA states that purines (A,G) should bind with pyramidines (T,C) the ...

Q: 1. Hugo de Vries hypothesized that the characteristics were transmitted via some sort of particle th...

Q: Stomach 4x or 10x label lumen , simply columnar epithelium gastric pits mucosa layers , submucosa m...

A: Introduction: Stomach is a J-shaped muscular, bag-like organ of the digestive system. It is located ...

Q: Do Gram-positive bacteria grow on PEA agar? If not, what prevents their growth?

A: Bacteria are common, mostly free-living organisms that are often made up of only one biological cell...

Q: Describe the effects of overgrazing on soil. What policies can be linked to the practice of overgraz...

A: Overgrazing is the consumption of grass or vegetation by animals. Overgrazing usually has harmful ef...

Q: Define the process of Protein modification ?

A: Introduction: Protein modification is the process of enzymatic modifying proteins, that follows the ...

Q: How does DNA being the universal molecule of inheritance in all cells support evolutionary theory?

A: The genetic code and DNA reflect life's common ancestry. DNA similarities can reveal how closely rel...

Q: 2. Joanna has "short fingers" (brachydactyly). She has two older brothers who are identical twins; b...

A: Brachydactyly is the condition when fingers and toes become short.

Q: Gyraulus convexiusculus is the first intermediate host of: Echinostoma ilocanum Fasciola hepatica Op...

A: Gyraulus convexiusculus is a freshwater snail and can behave as an intermediate host of many parasit...

Q: Define a “sustainable” rate of soil loss. Describe how you might determine whether a given farm was ...

A: Soil erosion is a slow process that occurs when the flow of water or wind detaches and removes soil ...

Q: In squash: what are the browning reactions in squash? What are the present vitamins, minerals are ...

A: Squash come under the genus Cucurbita, squash is rich in multiple vitamins and minerals. Vitamins li...

Q: While providing anesthesia for a 15-month-old, 5-kg girl undergoing strabismus surgery, you notice t...

A: The answer here is CRANIAL NERVE V ( TRIGEMINAL NERVE )

Q: Explain about Formation of the RNA Polymerase II Transcription Initiation Complex ?

A: The process of transcription (synthesis of RNA from DNA) is initiated when RNA polymerase binds to t...

Q: Sketch a series of diagrams showing each of the following, making sure to end each series with haplo...

A: Cell division is a process known as meiosis. Four haploid cells are supposed to define that they are...

Q: Q7. Meselson and Stahl conducted an experiment to prove that the replication of DNA is semi-conserva...

A: The experiment performed by Meselson and Stahl revealed the model of DNA replication.

Q: Prokaryotes and lower eukaryotes such as yeast have transcription control elements called upstream a...

A: Upstream activation sequences plays essential role in induction, enhancement and expression of gene ...

Q: 31. Which of the following is true? A.In a catabolic reaction, molecules assemble into smaller ones ...

A: Metabolism can be divided into catabolism and anabolism.

Q: Q1. The total area of a haemocytometer chamber is . a) 1 mm? b) 15 mm? c) 16 mm? d) 9 mm? Q2. Trypan...

A: The hemocytometer was originally invented by Louis-Charles Malassez to count blood cells. A hemocyt...

Q: Age (in years), x Ix log I(x) 1 3 0.43662 2.640103 0.239437 2.379191 3 0.140845 2.148742 4 0.109155 ...

A: The survivor ship curve are the graphic representation of the number of individuals in a population ...

Q: What type of grazing fish is this?

A: Grazing fish eat a wide variety of food organisms by biting them. They usually go in groups. Althoug...

Q: Please choose all the ADVANTAGES of protein-based drugs such as antibodies compare to small molecule...

A: When ingested into a living system, drugs are any chemical compounds that affect/alter the metabolis...

Q: Hello, good day. I have a problem answering this question, and I need your help. Hoping for a respon...

A: The hereditary material in humans and almost all other organisms is DNA or deoxyribonucleic acid. Th...

Q: a botanist wants to see how different colored light waves influence the growth of pea plants. she pu...

A: Control variables are variable that is kept constant but can influence the experimental outcomes. Th...

Q: What is the main idea of the passage? A study shows that African wild dogs catch about sixteen perce...

A: The main idea of the passage should include the following notions: - Earlier thought was that Afric...

Q: What are the Main physiological fuctions for Asthma explain the main function(s) the main mechani...

A: Asthma is a condition in which the person will be having difficulty in breathing. It is due to the c...

Q: In which lobe of the cerebral cortex, the primary olfactory cortex lies ? [A] Frontal lobe [B] Tempo...

A: Option B is the correct choice.

Q: In your own word, what is entomology?

A: Entomology is a subject in biology. Broadly Biology is divided into botany and zoology. Botany is t...

Q: Summarize the relationship between the population size of foxes and mice. O If the number of foxes i...

A: In a food chain survival of one species depends upon the presence or absence of a species on the tro...

Question

What is the coordinate for this TSS?

contigt:9,846-9,856 11 bp.
potion or rch term
Scle
5 bases
dmapene
cotigt
ROsol
RAss
Fytase Genes
tra-
traRA
Transcription Start Stes idertilied by modENCoDE
TSS re 165841So
mosENCODE NA-Ses trom D. melanogaster Whole Adut Females
Adut Females

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Compare and contrast endocrine and exocrine glands.
Match each of the follwoing
Asap plz all parts
Describe metabolism. Thank u
IPSCs are nearly identical to human embryonic stem cells in terms of gene expression, but there may be other ways in which they are not equivalent. For example, the telomeres of IPSCs often vary in length, with many IPSCs cells having telomeres shorter than those of embryonic. How might shortened telomeres affect the life-span of IPSCs or of differentiated cells derived from them?
A rubbery secreted matrix or proteoglycans and collagen surrounds living cells in _______. a. bone b. cartilage c. adipose tissue d. blood
Step1:Clickwhereitsays“StartaNewGame.”Inordertomakenewbodycells,thecellcycle mustoccur.Duringthecellcycle,onecelldividestoformtwodaughtercellswithexactlythe same___________.Thecellcycleincludesthefollowing:________________________________, _________________________,and_________________________.Interphasehappens__________ ______________.DuringInterphase,thecelldoesnormalactivities,likemakingproteins,for example.
Not sur ehow ot go about #'s 1, 2, and 3.
Major functions of KMLTTB
TGTCTAGTTGGCAATTGTCCTAGCCATACTGT
It is not an easy matter to assign particular func-tions to specific components of the basal lamina, sincethe overall structure is a complicated composite materialwith both mechanical and signaling properties. Nidogen,for example, cross-links two central components of thebasal lamina by binding to the laminin γ-1 chain and totype IV collagen. Given such a key role, it was surprisingthat mice with a homozygous knockout of the gene fornidogen-1 were entirely healthy, with no abnormal phe-notype. Similarly, mice homozygous for a knockout of thegene for nidogen-2 also appeared completely normal. Bycontrast, mice that were homozygous for a defined muta-tion in the gene for laminin γ-1, which eliminated just thebinding site for nidogen, died at birth with severe defectsin lung and kidney formation. The mutant portion of thelaminin γ-1 chain is thought to have no other functionthan to bind nidogen, and does not affect laminin struc-ture or its ability to assemble into the basal lamina.…
discuss the cellular senescence, DNA damage and chronicn inflammation, in regards to effects of ageing on the functionality of T. For each one provide a diagram to back answer. Proivdes examples on what disease can arise if there are any complicaions. Give age ranges.