What is the effect on OCR and ECAR of adding DNP to the cell culture?
Q: how is peptide molecules similar to biuret molecules
A: Introduction: Peptides are short polymers of amino acids that are connected by peptide bonds. It is…
Q: An unknown amino acid labeled BAYOKEM has an IpH value equal to 5.97. 1. If its pka2 is equal to…
A: pH is the measure of the strength of H+ ion or Hydronium ions in solution. pOH is the…
Q: what is the relative activity and the degree of inhibition caused by a competitive inhibitor when…
A: Enzymes are biocatalyst that increases the speed of reaction by lowering the activation energy.…
Q: When the cell needs both NADPH and ATP, the most likely utilization of the Pentose Phosphate Pathway…
A: The pentose phosphate pathway synthesizes NADPH and pentose sugars required by the cells. The…
Q: Which exemplifies substrate level phosphorylation? O Glucose + ATP --> Glucose-6-phosphate…
A: Substrate-level phosphorylation is a metabolism reaction that aids in the transfer of a phosphate…
Q: ______ 1. is the name of the enzyme that catalyzes the hydration of carbon dioxide to bicarbonate…
A: Enzymes are biocatalysts which increase the rate of biochemical reactions. The CO2 formed in the…
Q: An interaction from a protein structure is shown below. This interaction is commonly referred to as…
A: An amino acid-chain molecule has a three-dimensional structure made up of atoms arranged in rows…
Q: Malate dehydrogenase has a ΔGo′= 29.5 kJ/mol for the formation of oxaloacetate from malate yet plays…
A: Malate dehydrogenase is an enzyme that reversibly catalyzes the oxidation of malate to oxaloacetate…
Q: Which of the following is not an example of horizontal gene transfer? the transmission of genetic…
A: A bacteria is a prokaryotic organism of unicellular nature. Bacteria viruses are known as…
Q: How does the DNA hold information?
A: Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that coil around each…
Q: The lipophilic compounds do not interact with any chiral receptors within the cell membrane, and it…
A: Lipophilicity is a key assets in processes, along with intestinal absorption, membrane permeability,…
Q: Properties of Body Fluids.
A: "Since you have posted multiple questions, we will answer the first question for you. If you want…
Q: Glucose transporter allows glucose to move only in one direction to prevent loss from the cells.…
A: Permeability barrier and semi permeability of cell membrane are both maintained by lipids.…
Q: How many enyzymatic reactions are there in glycolysis pathway?
A: There are 10 enzymatic reactions in glycolysis pathway.
Q: Why is fumarate hydrated? To enable it to interact with an enzyme O To form a double bond To reduce…
A: Introduction: The citric acid cycle is the final common pathway for the oxidation of various…
Q: In terms of structure, what is the commonality between aldolase (glycolyssis) and transaldolase…
A: Aldolase is an enzyme that is involved in glycolysis and it converts fructose-1,6-bisphosphate into…
Q: Draw, label, and explain the three stsges of lipid oxidation
A: Lipid peroxidation may be defined usually as a technique below which oxidants consisting of…
Q: 2. Use your knowledge of amino acids (and the R groups) and tertiary structures of proteins to…
A: Amino acids are monomers of protein they are linked with each other by forming…
Q: If a base, such as sodium hydroxide (NaOH) were added to milk, would the protein precipitate? Why or…
A: Milk is a great source of vitamins and minerals, especially calcium. Milk plays a crucial role in…
Q: ACTIVITY 6.2.6 Give the complete name of the disaccharides below: 1. Lactose 2. Cellobiose
A: Essentially, a disaccharide is made up of two monosaccharides (simple sugars) linked together. A…
Q: Why are there reversible steps in the glycolytic pathway? Explain why they all be could not be…
A: Glycolysis is a process in which one molecule of glucose is converted to two molecules of…
Q: Identify the binding interactions that might be possible for the drug reported below. Rank these…
A: Negative interaction with the Amino acid residue of the target, positive interactions with the Amino…
Q: AAAGAGAAAAGAAUA to AAAGAGAAAUGAAUA. Suppose the codon sequence has a single base pair mutation If…
A: Introduction: Mutations are changes in the genetic material or character of an organism. It can…
Q: 1. Lac and Trp Operon are two different processes of sugar and amino acid. Describe the differences…
A: The operon model explains how gene regulation occurs at the transcription level in bacteria. The Lac…
Q: 30. assicuatuib if 2alpha and 2 beta chains to form adult hemoglobin
A: HbA2 is a gene that in encodes for the alpha globin chain of haemoglobin in humans.
Q: Determine the p50 for variant A to the nearest 5 torr (i.e., if the p50 was 12, you would write 10).…
A: The oxygen haemoglobin dissociation curve plots the proportion of haemoglobin in its saturated form…
Q: Draw amylose and cellulose. Explain the differences Can we digest both molecules? Why or Why not?
A: Both Amylose and Cellulose are polysaccharides containing glucose residues.
Q: A patient is suspected of having low stomach acid, a condition known as hypochloridia. To determine…
A: The gastric sample here is acidic. The equation of titration of an acid (sample in this case) with…
Q: State the significance of HMP shunt
A: The pentose phosphate pathway is also called the hexose monophosphate shunt pathway.
Q: Movement of water is controlled by which factor?
A: Movement of water occurs through the xylem cells of plants to reach all parts of plant body . As…
Q: 9. Which of the following changes would not affect a peptide GENSHIN? A. Heat B. Inorganic Salts C.…
A: Proteins are unbranched polymers constructed from 20 standard α-amino acids. They have four levels…
Q: Cellulose cannot be digested and thus does not contribute to the caloric intake in humans. A) True…
A: Cellulose is an intricate organic compound found in large quantities in nature. It is a polymeric…
Q: 3. How does dimerization of a receptor tyrosine kinase promotes autophosphorylation of the…
A: The tyrosine kinase-associated receptors contain an N-terminal extracellular ligand-binding domain,…
Q: 6. Gluconeogenesis generates ________. Select one: A. 2 ATP and 2 NADH B. 1 ATP and 1 NADH C. 1…
A: Gluconeogenesis is a metabolic pathway that results in the generation of glucose from certain…
Q: 4 Chitin and Amylopectin
A: Most carbohydrates found in nature occur as polysaccharides, polymers of medium to high molecular…
Q: What is the principle of dialysis? A. Highly soluble contaminants will be removed as the…
A: The removal of contaminants from a protein sample is important in the purification of proteins.
Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA", what is its complementary…
A: Deoxyribonucleic acid (DNA) is a nucleic acid that carries genetic information from parent to…
Q: Use the data below to determine the maximum velocity [in mM/s] of a certain enzyme-catalyzed…
A: We must know the Michaelis Menten equation: V=Vmax [S]Km+ [S]
Q: A protein that has been reversibly denatured has Multiple Choice temporarily lost part or all of its…
A: Each protein has its own distinct sequence of amino acids, and the interactions between these amino…
Q: Contrary to legend, camels do not store water in their humps, which consist of large fat deposits.…
A: Tripalmitoylglycerol is formed by three palmitoyl-CoA molecules. As a result, it is required to…
Q: Which of the following describes the correct order of energy conversions necessary to form…
A: Bioenergy is described as one of the most crucial resources that are available in order to meet the…
Q: 38. "The sterol is a precursor to all compounds except" A.ergosterol B.testosterone C.bile salts…
A: We'll answer the first question since the exact one wasn't specified. Please submit a new question…
Q: A plant isolate was subjected to qualitative tests to determine the presence of macromolecules.…
A: Plant isolates are obtained from different tissue homogenate samples of plant parts. Usually, a…
Q: write the structure of the following nucleotides: 1. 5'-dGMP 2. 5'-dGDP 3. 5'-dGTP 4. 5'-GTP 5.…
A: The nucleotides are the phosphoric acid esters of nucleosides with the phosphate at the C-5'…
Q: What is Therapeutic Drug Monitoring (TDM) and under what circumstances would it be considered for a…
A: Therapeutic drug monitoring (TDM) is commonly described because the medical laboratory size of a…
Q: Glycolysis is an energy-generating pathway. How much of each of the following is produced when…
A: Glycolysis is the process in which one mole of glucose is oxidized to two moles of pyruvate. It…
Q: evidence of Bial's test to show a positive result for the presence of a specific sugar
A: Bial's test is a chemical test used to test for Pentose sugar. It includes chemicals like orcinol,…
Q: In the indicated tissues, how will each process or the activity of each enzyme below be affected by…
A: Glucagon is a hormone secreted by the alpha cells in pancreas. It is a principle hormone regulates…
Q: What is expected to happen to a suspended protein when the pH of the solution is adjusted to the…
A: The pH impacts the precise nature of protein interactions by altering the protonation state of…
Q: n. The diagram below shows the kinetic plot of collagenase with varied substrate concentration.…
A: enzyme activity is defined as the total concentration of substrate converted into product per unit…
What is the effect on OCR and ECAR of adding DNP to the cell culture?
Step by step
Solved in 2 steps
- What is the effect of trypsin EDTA solution on monolayer cell culture preparation?Can lactic acid culture infect the human gastrointestinal tract? If yes, why is this method not used to treat lactose-intolerant individuals?What are the specific E. coli strains used to make competent cells? Explain the characteristics of these strains