what is the expected number of individuals of Aa bb Cc genotype if 1000 progeny result from this testcross with a coefficient of coincidence (9 of 0.5?
Q: B) You cross another heterozygous (AaBb) female bunny, Penny, whose haplotype you do not know. If…
A: A test cross is a trial cross of a singular organism of dominant phenotype of unknown genotype and…
Q: The fact that muscles and skeletons work together to move the body from place to place is an example…
A: Living organisms exhibit life processes that are absent in nonliving objects.
Q: in 250 words and in own words Explain the role of the components of a spinal reflex arc.250 words…
A: A reflex arc is defined as a neural pathway that controls a reflex. The usual pathway would have…
Q: Give the economic and ecological importance of Bamboo (the subfamily Bambusoideae).
A: Bamboos are a diverse group of evergreen perennial flowering plants in the subfamily Bambusoideae of…
Q: What plant process involved in your experiment aside from transpiration?
A: Plants are vital living forms that belong to the Plantae taxonomic kingdom and are further classed…
Q: Is there a difference in the absolute values of force generated by females and male in EMG? Yes or…
A: An individual's dominant arm is the one that is used the most frequently. The two arms generate…
Q: The students of a Microbiology class were tasked to transfer or subculture a pure culture of…
A:
Q: 13 15 DSS karyotic organisms that cause infections eases that can't be caught (passed from person to…
A: Disease is a state of illness which could be contagious that is spread from person to person or…
Q: Identify the molecule shown below. You may also see the molecule by clicking on this link. H H HO O…
A: Answer
Q: Change in gene frequencies within a reproductive population is called: O allopatric speciation. O…
A: Evolution is defined as a change in the inheritable traits of biological populations, over multiple…
Q: You would like to design a method to treat the most common mutation that causes sickle cell anemia…
A: Precise genome editing is a potential technique for discovering causative genetic variations and…
Q: SARS-CoV-2 was shown to be transmissible even when the carrier has no symptoms. How did this…
A: SARS virus is a positive strand RNA virus and belongs to coronavirus family.
Q: Distinguish between positive and negative control. Give examples of each from the lac operon
A: Operator is a unit consisting of one or more cistrons that function coordinately under the control…
Q: How do plants and animals regulate their body fluids? Why do you think body regulation is important…
A: The regulation of concentration of body fluids is called as osmoregulation. • The plants absorb…
Q: The distinction between SLA and HDD may be explained as follows:
A: Disease It is a particular abnormal condition that negativity affects the structure or function of…
Q: Leos results were like the followings Time Color Specific Gravity Protein Glucose pH Before exercise…
A: ADH or anti diuretic hormone is produced by hypothalamus. It is released into blood and it helps in…
Q: Substance that moves the electrical field solely depends on the speed of the substance in the…
A: 1. Substance that moves the electrical field solely depends on the speed of the substance in the…
Q: What causes allele frequencies to differ between biological populations?
A: Allele frequency Allelic frequency can be defined as relative frequency of an allele at a…
Q: What is corpus luteum. How does it function as an endocrine gland?.
A: Introduction :- During the ovulatory phase, when an ovarian follicle releases an egg, the opened…
Q: How can you tell someone’s social class? What indicators can be misleading?
A: A group of members present in a society divided on the basis of their social and economical status…
Q: Some types of hormones regulate appetite. Which the hormones trigger the feeling of hunger and which…
A: The hormone which majorly triggers the feeling of hunger is Ghrelin. It is also known as the “hunger…
Q: Short Answer 1. A. You are crossing bunnies. The haplotype of a female bunny, Poppy, is as shown in…
A: The independent assortment of genes states that the alleles of different genes are assortment…
Q: Do the following mathematical calculations to figure out the work each hand did: Work = 1…
A: Introduction The relationship between two versions of a gene is referred to as dominant. Each parent…
Q: Answer the following questions about this phylogenetic tree. What animal represents the out group in…
A: According to bartleby guidelines, only the first three subparts have been answered. Kindly post the…
Q: Marie diluted her phage lysate from 10° to 109. She completed the titer assay protocol using these…
A: This question is about dilution.
Q: OLD STRAND NEW OF DNA REPLICATION TCG ATT ACT 1 ACT AGT ACT 4 AGG ACC TAC CTG TAG 7 AGG STRAND OF…
A: DNA (Deoxyribonucleic acid) and RNA are two examples of nucleic acids (Ribonucleic acid).…
Q: You have a photoreceptor cell in a dish. You are recording its membrane potential while flashing…
A: Answer :- Option (B) is correct. - The cell depolarizes, with brighter light causing more…
Q: identifying the type of bacteria I have cultured. I know that it is gram-negative and cocci in…
A: There is only two type of bacterias which do not grow so well on EMB medium. 1. Shigella 2.…
Q: Benzoic acid has an absorption maximum at 230 nm. Where do you expect (give a value) to see the…
A: The neutral benzoic acid is acidic in nature and at pH lower than 7 benzoic acid obtain high…
Q: BLASTP helps to predict the function of phage proteins by finding the e-value of phage proteins O…
A: ANSWER) (a) finding the e-value of phage proteins The BLASTp helps to predict the function of phage…
Q: Leo, 37-years old was absolutely shocked when he found out that he has a hypertension. He was once…
A: Kidney are the chief organ of Urinary system in which formation of urine takes place via nephrons as…
Q: Binding of epithelial growth factor (EGF) to its receptors will result in Ras A) shutting down cell…
A: .A gene that controls cell proliferation and can function as a transcription factor, growth factor,…
Q: Define toxicology dose and response
A: Toxicology Dose response curve is defined as the response of target host to various doses of toxic…
Q: Upon what principle does bactofugation depend? Why might its use be desirable in processing milk…
A: Bactofugation is a centrifugal method for eliminating microbe spores from milk, particularly when…
Q: (Select one answer from dropdown menu and fill in the blanks:) When a sperm and an egg cell called a…
A: The mechanisms that work to stimulate or suppress the transcription of a gene are referred to as…
Q: why a mutant Ras is an oncogene causing many human cancers
A: Ras proteins are proto-oncogenes that are frequently mutated in human cancers.
Q: 1 Why is the bulk milk hauler an important link in assuring high-quality milk for humans? What…
A: Bull milk contain high amount of calcium and minerals. These are necessary for bone develpoment.…
Q: of
A: The main purpose to do homogenization of the milk is to break the large fat globules and then create…
Q: Write down the complementary mRNA sequence for each of the following DNA sequence. A:…
A: If template sequence of the DNA is A.. mRNA is .. AUGGAUCGCGUGUACAUCCACCCGUUUCAA
Q: The eukaryotic metallothionein gene promoter consists of all EXCEPT: (A) MRE (в) GC Box c) GRE D…
A: Introduction Metallothionein is a protein that has a high affinity toward binding heavy metal ions,…
Q: Provide an example of a well known group (taxonomic) name that has been rendered non-monophyletic…
A: Answer :- Taking care of the fundamentals of taxonomy categorization and how to peruse phylogenetic…
Q: How antigen and antibody detection ELISA's similar and different?
A: ELISA or Enzyme linked immunosorbant assay are quantitative immmunological procedures in which the…
Q: Styles raph Lungfishes Amphibians Mammals Tetrapod limbs Lizards and snakes Amnion Crocodiles…
A: A tree like or comb like taxonomic relationship among different group of organisms is called…
Q: You are recording from a touch receptor in skin. When you stimulate a spot on the skin, the receptor…
A: Answer :- Option (B) is correct. - Whether the receptor sends its output to the somatosensory cortex…
Q: What is the significance of Juxtaglomerular apparatus in kidney function.
A: Urinary system is a part of body system which generally involved in formation of urine and it's…
Q: Besides the Warrior gene, the only other genetic mutation directly correlated with “super-maleness”…
A: As mentioned in many scientific literature the warrior gene which is normally referred to as MAOA…
Q: Give the number of cleavage of uvarovite, grosullar, and andradite?
A: Garnet is a mineral group made composed of many closely related minerals. Garnet minerals share…
Q: Which of the following is NOT a true statement? Action potentials are generated only when a neuron…
A: There are few important points that should be kept in mind: Neurons possess electrical excitability…
Q: Explain the signaling steps that take place after the EGF receptor is dimerized, up to the poiunt…
A: As per our company guideline we are supposed to answer only first question or only first 3 subparts…
Q: economic and ecological significance of Rye (Secale)
A:
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 2 images
- Two gene loci, A and B, assort independently, and alleles Aand Bare dominant over allelesa and b. Indicate the probabilities of producing the following: 1) An AB phenotype from a cross AaBb × AaBb?From a presumed testcross A/a × a/a, in which A represents red and a represents white, use the χ2 test to findout which of the following possible results would fit theexpectations:a. 120 red, 100 white b. 5000 red, 5400 whitec. 500 red, 540 white d. 50 red, 54 whiteFrom a presumed testcross A/a × a/a, in which A represents red and a represents white, use the χ2 test to find out which of the following possible results would fit the expectations:a. 120 red, 100 white b. 5000 red, 5400 whitec. 500 red, 540 white d. 50 red, 54 white
- A poultry grower has 2 breeds of chicken, averaging 9 and 5 lbs. inweight. The F1 of the cross between is quite uniform, averaging 7lbs. Of the F2 progeny, 0.4% is as heavy as either parent. a. How much does each effective allele contribute to weight? b. What is the number of polygenes pairs involved in thesecrosses? c. If only those with an average weight of 6-8 lbs. are marketable, whatpercentage of the offspring will yield profit for the grower?In a species of firefly, wide wings (W) are dominant to narrow wings (w) and graybodies (C) are dominant to brown bodies (c). A WwCc and wwcc fly were mated andproduced the following offspring: (in the picture attached) What is the recombination frequency for this cross (in percent)?In letter B: If the map distance equals the number of recombinant/total of offspring, wouldn't it be 24/806 x 100? Wouldn't we add both recombinants? Can you explain letter C? I don't grasp that concept well. And since I'm using my question already, would you be able to answer D. Thank you!
- A dihybrid cross is performed between two heterozygous individuals (heterozygous for two traits). The resulting offspring had 62 individuals that were dominant for trait 1 and 2 (D/D), 7 individuals that were R/R, 21 individuals that were R/D, and 25 individuals that were D/R. Using Mendelian inheritance as the null hypothesis, use χ2 analysis to determine if the trait follows Mendelian inheritance. A. How many D/D phenotype offspring are expected? B. How many R/D phenotype offspring are expected? C. How many degrees of freedom are there? D. What is your calculated χ2 value? E. What is the critical value if using a probability of 0.05? F. Does the trait follow Mendelian inheritance?A researcher performed a testcross with of an individual that was Dd Hh genotype. Which ratio would best represent the expected genotypic results from a data set of 400 offspring?The answer is D, but why?. A geneticist mapping the genes A, B, C, D, and E makestwo 3-point testcrosses. The first cross of pure lines isA/A ⋅ B/B ⋅ C/C ⋅ D/D ⋅ E/E × a/a ⋅ b/b ⋅ C/C ⋅ d/d ⋅ E/EThe geneticist crosses the F1 with a recessive tester andclassifies the progeny by the gametic contribution ofthe F1:A ⋅ B ⋅ C ⋅ D ⋅ E 316a ⋅ b ⋅ C ⋅ d ⋅ E 314A ⋅ B ⋅ C ⋅ d ⋅ E 31a ⋅ b ⋅ C ⋅ D ⋅ E 39A ⋅ b ⋅ C ⋅ d ⋅ E 130a ⋅ B ⋅ C ⋅ D ⋅ E 140A ⋅ b ⋅ C ⋅ D ⋅ E 17a ⋅ B ⋅ C ⋅ d ⋅ E 131000The second cross of pure lines is A/A • B/B • C/C • D/D •E/E × a/a • B/B • c/c • D/D • e/e.The geneticist crosses the F1 from this cross with arecessive tester and obtainsA ⋅ B ⋅ C ⋅ D ⋅ E 243a ⋅ B ⋅ c ⋅ D ⋅ e 237A ⋅ B ⋅ c ⋅ D ⋅ e 62a ⋅ B ⋅ C ⋅ D ⋅ E 58A ⋅ B ⋅ C ⋅ D ⋅ e 155a ⋅ B ⋅ c ⋅ D ⋅ E 165a ⋅ B ⋅ C ⋅ D ⋅ e 46A ⋅ B ⋅ c ⋅ D ⋅ E 341000The geneticist also knows that genes D and E assortindependently.a. Draw a map of these genes, showing distances inmap units wherever possible.b. Is there any evidence of interference?
- Two organisms, AABBCCDDEE and aabbccddee, are mated to produce an F1 that is self-fertilized. If the capital letters represent dominant, independently assorting alleles: (a) how many different genotypes will occur in the F2? 3^5=243(AaBbCcDdEe) (b) what proportion of the F2 genotypes will be recessive for all five loci? (c) would you change your answers (a and/or b) if the initial cross occurred between AAbbCCddee X aaBBccDDEE parents? (d) would you change your answers (a and/or b) if the initial cross occurred between AABBCCDDEE X aabbccddEE parents?Given the map a 15 b 24 c (where 15 and 24 are the respective map distance between the loci) with a coefficient of coincidence of 0.5, how many “abc” phenotype individuals would be observed among 1000 progeny of a testcross to the following:. A snapdragon plant that bred true for white petals wascrossed with a plant that bred true for purple petals, andall the F1 had white petals. The F1 was selfed. Among theF2, three phenotypes were observed in the followingnumbers:white 240solid purple 61spotted purple 19Total 320a. Propose an explanation for these results, showinggenotypes of all generations (make up and explain yoursymbols).b. A white F2 plant was crossed with a solid purple F2plant, and the progeny werewhite 50%solid purple 25%spotted purple 25%What were the genotypes of the F2 plants crossed?