Q: Fill in the table. Nucleic Acid Comparison DNA ml
A: Nucleic acid- It is an macromolecule found in all type of cell. In other word you can says that…
Q: hat are the steps in creating a dna profile
A: DNA profiling is also known as DNA fingerprinting. It is often used to identify the origin and…
Q: Which of these is not a tool for comparing DNA sequences? PLINK Fasta BLAST A dotplot e.g. dotlet
A: DNA polymerase is an enzyme. A primer is a single-stranded DNA fragment that binds to template DNA…
Q: The enzyme responsible for separating double-stranded DNA intosingle-stranded DNA isa. DNA…
A: Genetics is a piece of science worried about the assessment of genes, genetic collection, and…
Q: Choose the combination of answers that most accurately completes the statement.Which of the…
A: PCR is a technique that results in exponential amplification of a selected region of a DNA molecule…
Q: TRUE OR FALSE. a) The Sanger method of DNA sequencing follows the principle of complementarity just…
A: The standard DNA sequencing technique is the Sanger method, which was developed by Frederick Sanger…
Q: During gel electrophoresis, DNA fragments are separated such that the longest DNA samplas migrate…
A: It is false The true statement is- during gel electrophoresis DNA fragment are separated such that…
Q: Evaluate the gel provided below. Use the notes to help you read the gel: DNA is loaded in the wells…
A: Polymerase Chain Reaction is a method used to make millions of copies of a specific DNA sample.…
Q: Unclassified Intergenic DNA Occupies a Significant Portion of the ___________.
A: Answer: Introduction: Intergenic DNA contains any DNA which is 5′ or 3′ from the start or stop…
Q: Restriction enzymes bind to specific sequences of DNA to seal them together. True False
A: Restriction enzymes bind to speffic sequence of DNA seal them together. This is TRUE. Restriction…
Q: Please use the below DNAs and complete 4 steps question. Thanks1
A: Replication : It is the biological process of producing two identical replicas of DNA from one…
Q: 3000 bp 2000 bp 1000 bp 800 bp 700 bp 500 bp L Uncut EcoRI 1 BamHI Ncol EcoR1/BamH1 BamHI/Nco1…
A: Use the gel to answer the following questions. You will be constructing a map of the plasmid,…
Q: You have a mixture of different types of cells (plant, animal, fungal, bacterial, archael cells) in…
A: DNA extraction The process of removal of DNA from from the cell is known as DNA extraction.
Q: Identify the solution component that contains the extracted DNA.
A: Ethanol precipitation method is generally used for DNA extraction.
Q: Complete the table to determine the amounts of other nucleotides found in each DNA sample.
A: DNA Sequencing A laboratory process used to learn the exact sequence (order) of the four building…
Q: Determine whether sample 1 and sample 2 are plasmid OR genomic DNA, justify your answer
A: By observing the bands of the two samples; we can say that sample 1: Lane 2: PBR3222 : A clear and…
Q: The diagram below shows an autoradiograph ofa DNA sequencing gel. Write the 5' to 3' sequence of the…
A: DNA sequencing is a method used to determine the organism’s actual DNA. The most commonly used DNA…
Q: Which of the following is not a part of the Sanger method tosequence DNA?a. dideoxynucleotides b.…
A: Sanger sequencing is additionally called Chain termination method. DNA sequencing is the process to…
Q: 3000 bp 2000 bp 1000 bp 800 bp 700 bp 500 bp L Uncut EcoRI BamHI Ncol EcoR1/BamH1 BamHI/Nco1…
A: Plasmids are double-stranded circular DNA molecules. Due to their small size and stability, these…
Q: When running a gel during a Sanger sequencing, the following results were obtained: I I Find the DNA…
A: Sanger sequencing is a technique which is used to determine the order of the four nucleotide bases…
Q: DNA profiling identifies a person by the similar parts of his or her DNA True Fals
A: DNA profiling The application of the molecular biology is largely dependent on its application in…
Q: Need to understand how to do this: create the complementary strand of DNA to the DNA strand provided…
A: DNA is a double helical structure that comprises of tel strand running in opposite directions. Both…
Q: GAATTC GAATTO CITAAG CITAAG double-stranded DNA DAATT DAATTO CTAA G CTAA GI AAT TO CTTAA GAATTO…
A: The cloning is routinely used in biotechnology laboratories and it is the process by which a foreign…
Q: Match the definition on the left with the term on the right Tightly hypercolled DNA that is not in…
A: The DNA is the genetic material in human that is present within the nucleus of a cell. This DNA…
Q: Refer to the DNA profiles comparing the DNA obtained from the three suspects with the crime-scene…
A: The process of DNA Fingerprinting id best described as the process or technique which is used to…
Q: a) what si the nucleotide at the 5 prime end of the picture? b) what si the DNA sequence from 5…
A: This is the picture of sanger sequencing gel. The first band is the largest one and subsequent bands…
Q: Replicate the DNA strand AAGGCTAACGGCATTTAACCC. Transcribe the DNA strand AAGGCTAACGGCATTTAACCC.…
A: In most organisms, genetic material is stored in the form of DNA. In humans, each cell's nucleus has…
Q: C. Estimating DNA concentration - creating a 2-fold dilution series. Can you estimate how much DNA…
A: DNA Concentration Estimation -- In molecular biology ,purity and quantitation of nucleic acids is…
Q: Which of these is not a tool for comparing DNA sequences? O PLINK O A dotplot e.g. dotlet O Fasta O…
A: There are different tools in bioinformatics that help in sequencing and comparing the DNA sequences.…
Q: Below is a double stranded DNA molecule with a replication bubble. The filled lines represent the…
A: DNA replication refers to an enzyme-mediated complex process that produces replicate or copies of…
Q: Elaborate on the multidisciplinary applications (at least 3) of Recombinant DNA Technology. Give…
A: The recombinant DNA (rDNA) is an innovation that utilizes enzymes to reorder together DNA sequence.…
Q: DNA Gene Trait DNA Replication Nitrogen Base Chromosome
A: DNA DNA or Deoxyribonucleic acid is a molecule that contains the instructions, required for the…
Q: Give the DNA compliment to the following DNA strand. GAA CTT a b. GAA CUU BRB
A:
Q: constructing a map of the plasmid, pDiddy. What is the smallest fragment size that the…
A: Double digestion Restriction enzymes are eye enzymes that induce cuts(cleavage) at their specific…
Q: Find a recently developed, automated DNA extraction technique/equipment and explain it in detail
A: Deoxyribonucleic acid (DNA is the genetic material. It is extracted for the genetic experiments such…
Q: Definition of Terms( This is all about Applications of Recombinant DNA){ 2-3 sentences only) a.…
A: Recombinant DNA is the process of insertion of molecules of DNA from two different species into a…
Q: The table shows the presence/absence and size of DNA bands of known samples using gel…
A: Electrophoresis is the separation of molecules in an agarose gel, under the influence of an electric…
Q: What is it about the structure of DNA that allows it to be replicated so exactly, thus making it so…
A: Definition DNA replication is the biological process of producing two identical replicas of DNA…
Q: Identify the false statements. There may be more than one correct answer. A) The binding of DNA to a…
A: Genomic DNA and plasmid DNA are isolated using silica resin columns than using traditional…
Q: The steps that involve complementary base pairing is the second step in which the nucleotide is…
A: 1. DNA replication is the process by which two identical copies of the DNA template strand is…
Q: How to AMLIFY dna sequence and CONFIRM its expected size
A: PCR (polymerase chain reaction is a technique through which a DNA segment is copied to a million…
Q: Give the DNA compliment to the following DNA strand. CTA a DNA BTW GAT СТА
A: DNA is the Genetic meterial which found in eukaryote and some prokaryotes. It is mainly double…
Q: In the figure, which ketter represents DNA polymerase 1 D AR AA BB C.C DD EE
A: Polymerase A kind of enzyme that make DNA or RNA from pre-existing DNA or RNA.
Q: Exit Ticket: Use the diagram below to answer the following questions. DNA Samples 1 2 3 4 5 6 7…
A: 1. The given diagram is the technique known as gel electrophoresis. By this technique the DNA, RNA…
Q: Some recombinant DNA techniques depend on the specific hybridization (or annealing) between two…
A: Recombinant DNA technology comprises altering genetic material outside an organism to obtain…
Q: DNA REPLICATION/REPAIR PROTEINS
A: DNA stands for deoxyribonucleic acid. DNA replication is a very important process in the life cycle…
Q: TFIIF Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an…
A: TFIIF It is a eukaryotic transcription factor. It is involved in the formation of the…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- The terms conjugation, transduction, and transformation are usedto describe three different natural forms of genetic transferbetween bacterial cells. Briefly discuss the similarities and differencesamong these processes?Giemsa stain produces G bands in metaphasechromosomes. The pattern of G bands is highly specificand reproducible, allowing identification of _____________-and gene locations.In E. coli, the genes purC and pyrB are located halfwayaround the chromosome from each other. These genesare never cotransformed. Why not?
- Calculate the transformation efficiency of an experiment conducted using 10ul of 0.005 ug/ul plasmid, you plated 100ul out of a total volume of 500ul and the count of transformed colonies was 186.For each individual on gel, determine if the individual is homozygous for presence of the Alu insertion (++), heterozygous (+-), homozygous for the absence of the Alu insertion (- -), or if the results are inconclusive (I) (explain in detail what leads to your determination of each individual on the gel and why). Explain what may have caused any unexpected bands (neither 850 nor 550) lack of bands.Which well(A through E) of this agarose gel contains the smallest DNA size? Please look at the pic.
- A synthetic chromosome lacking most intergenic sequencesfunctions normally. Such synthetic chromosomes may helpto define a minimal yeast _______________?.The modular nature of eukaryotic activator proteinsgave scientists an idea for a way to find proteins thatinteract with any particular protein of interest. Theidea is to use the protein–protein interaction to bringtogether a DNA-binding region with an activation region, creating an artificial activator that consists oftwo polypeptides held together noncovalently by theinteraction.The method is called the yeast two-hybrid system,and it has three components. First, the yeast contains areporter gene construct in which UASG (an enhancerlike sequence that binds the activator Gal4 as describedin Problem 8) drives the expression of an E. coli lacZreporter (encoding the enzyme ß-galactosidase) from ayeast promoter. Second, the yeast also expresses a fusion protein in which the DNA-binding domain of Gal4is fused to the protein of interest; this fusion protein iscalled the bait. The third component is a cDNA librarymade in plasmids, where each cDNA is fused in frameto the activation domain of…Calculate the concentration of plasmid DNA if OD260 value is 0.74 and OD280 valueis 0.35 (taken into account the dilution factor (DF) of 20, and 1 O.D. at 260 nm for doublestranded DNA = 50 ng/ul of dsDNA).
- Choose the correct gel electrophoretic pattern that would be seen in dideoxy sequence analysis of the DNADNA molecule shown below. pGGCGACCGATTAGTCCCATCGATGGG−OHFour cosmid clones, which we will call cosmids A, B, C, and D, werehybridized to each other in pairwise combinations. The insert size ofeach cosmid was also analyzed. The following results were obtained:Compare and contrast the principle behind DNA migration in agarose gel electrophoresis from that of protein migration in SDS-PAGE.