Q: Compare and contrast preimplantation genetic diagnosis and genetic testing.
A: Pre-implantation genetic diagnosis (PGD) is commonly described as the examination of embryos or oocy...
Q: frequency of the wild type allele
A: Allele is one of two or more possible forms of a gene that are found at the same place on a chromoso...
Q: 4. Complete the table below Parent Cell(2N) Mitosis(2N) Meisios(n) 46 а. b. C. d.
A: Introduction Mitosis is an equational division in which the parent cell's chromosome number remains ...
Q: B. Make a punnet square for the following and give the phenotypic and genotypic ratio: 1. One homozy...
A: Answer 1- the cross between : GG x gg G g G GG Gg g Gg gg The phenotypic ratio of ...
Q: A cross between fruit files with genotypes Aa Bb × aa bb produces the following progeny: 10 Aa Bb 4...
A: In a cross, the arrangement of linked alleles on the chromosomes is critical for determining the out...
Q: Fixing free nitrogen from the air means converting into ions that can be used by many types of organ...
A: Nitrogen cycle It is biogeochemical cycle of nitrogen where nitrogen converted into many chemical f...
Q: 26. Plants with mycorrhizae don't grow as well as plants without mycorrhizae. 27. Fungi includes rus...
A: 26)False The true statement is "Plants without mycorrhiza don't grow as well as plants with mycorrh...
Q: Two pea plants are crossed, which are purebred. A father is round, terminal, violet and wrinkled, wh...
A: Genetics is the science that deals with the inheritance of the genes or characters from one generati...
Q: You are studying a genome that has 42% G:C content and the remaining 58% of the genome is As and Ts....
A: Restriction enzymes The enzyme that is use to cut the DNA at specific site.
Q: Draw the bond-line structure of the given peptides. 1. Ser-Asp 2. Glu-Gln 3. Arg-His
A: Bond line structure of the amino acids reveals the covalent bonding, hydrogen bonding and peptide li...
Q: Week 4 BIO 202 worksheet Blood vessels 1. What is the name of the outermost layer of a blood vessel?...
A: Note :- Since you have asked multiple questions im only answering the ist 5 as per bartleby guidelin...
Q: Drag and drop the appropriate labels onto the cross section of the Cut Bank below the Highlevel/LRT ...
A: 6)River deposits. 5) vegetated berm 1)top soil(with brick)
Q: Research has revealed that ____________ base pairs of DNA are wrapped ____________ times around a hi...
A: Introduction Deoxyribonucleic acid, or DNA, is a lengthy molecule that houses our unique genetic cod...
Q: Given that the transgene used is only upregulated in the brain and spinal cord of TMFN mice, what mi...
A: Medical technology has advanced significantly over the course of many centuries. According to studie...
Q: You have a purebreeding line of blue frogs and a purebreeding line of red frogs. You cross them and...
A: this is a case of Incomplete dominance answer is 1:3(purple:red)
Q: Discuss the different structures of protein. What are the five factors that promote protein folding ...
A:
Q: Fill in the blank. Words choice: • bud scales • nodes • apical meristem • axillary buds • internodes...
A: Angiosperm or flowering plants are the plants in which the seeds are embedded within the fruits. Thi...
Q: This case study is used to help illustrate the respiratory content you have been studying. It will a...
A: #Chronic bronchitis- This the long term inflammation of bronchi. This is common caused in chain smok...
Q: Bacillus cereus and Bacillus thuringiensis are very closely related species and cannot be distinguis...
A:
Q: The white Leghorn breed of chickens is homozygous for the dominant allele C, which produces colored ...
A: Ans) Homozygous: You inherit the same version of the gene from each parent, so you have two matching...
Q: 23. Describe each type of transposon and how they integrate into the DNA. How are transposons respon...
A: Genome is defined as the complete set of genetic information that make up all the chromosomes of the...
Q: 5 Describe the roles of GAP and GEF in activating GTPases?
A: GAP stands for GTPase activating proteins. GEF stands for Guanine nucleotide exchange factors .
Q: a paragraph, describe the feedback mechanism that happens in the femaile reproductive system
A: Answer
Q: Describe what happened if there is no biodiversit
A: Biodiversity: The biological variety and variability of life on Earth is referred to as biodiversit...
Q: What is the amino acid sequence coded by this mRNA? MET SER ARG ASP VAL THR VAL LEU VAL SER O GLN CY...
A: A codon table can be used to convert a genetic code into an amino acid sequence. Because messenger R...
Q: Why is energy flow is important in an ecosystem
A: Energy is an object's property that may be transferred to other objects or converted into different ...
Q: Give 3 examples of a hormone and provide the following information of each hormone: a. where is the ...
A: According to the question, we have to provide 3 examples of a hormone and provide the following info...
Q: B. Make a punnet square for the following and give the phenotypic and genotypic ratio: 1. One homozy...
A: Answer 1:- A monohybrid cross is a breeding experiment between organisms of the P generation (paren...
Q: Introduction of nervous system:
A: Introduction of the nervous system: The nervous system is the major controlling, regulatory, and com...
Q: The dermis is continually replaced.
A: dermis means a connective layer of tissue . the dermis is a fibrous structure of collagen elastic ti...
Q: The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1)...
A: Central Dogma: It is the complete procedure of replication, transcription, and translation of DNA. T...
Q: Explain at least three important roles for fungi growing in a temperate deciduous forest. What would...
A: Fungi are critical components of microbial communities living in a dynamic and complex soil environm...
Q: Cat ovary region? structure? layer? region? * Region: cortex or medulla
A: Above region is Cortex.. Lower region is medulla
Q: Restate Liebig’s Law of Minimum to include conditions/ factors in these present times. Explain your ...
A: Liebig's Law of the Minimum states that yield is proportional to the amount of the most limiting nut...
Q: Please match the term with the description. the anterior end of a tapeworm that attaches to the insi...
A: Phylum Cnidaria This phylum involves species that have different stages of the life cycle, these sta...
Q: When looking at TV with your legs stretched out, your messenteric arteries _________ so that blood c...
A: 41)Stretching of the legs causes increased blood supply of the arteries and decreased stiffness of t...
Q: How would you test an ecological hypothesis about endangerment of animals due to deforestation
A: Ecological factors associated with wild animals are harsher climate, temperature, luminance, moonlig...
Q: 12. Interpret the following table, where s is the selection coefficient for heterozygote advantage i...
A: Answer: In population genetics, a selection coefficient, usually denoted by the letter s, is a measu...
Q: If Photosystem I is inhibited, will H+ still be pumped into the thylakoid space? O No, because the e...
A: When an electron leaves PSII, it is transferred first to a small organic molecule (plastoquinone, Pq...
Q: A gardener received a pea plant from her neighbor, and she wants to know its genotype. The neighbor ...
A: homozygous dominant trait =round peas (RR) homozygous recessive trait=wrinkled peas (rr) Heterozygou...
Q: During the third step of PCR, Taq polymerase adds nucleotides to the growing DNA segments. Why is Ta...
A: Polymerase chain reaction i.e PCR is a molecular technique which is used to make multiple of the fra...
Q: Explain and draw Haploid and diploid and heterokaryotic lifecycle of fungi.
A: Life Cycle of Fungi : Fungi life cycle involve formation of haploid spores and their germination to ...
Q: Please help me with this.. What is the general consideration in the use Genetically Modified Fish fo...
A: Genetic engineering is a type of technology in which various genes that impart benefits to a partic...
Q: Data for two populations are shown below in Figs (a) and (b), respectively. The slopes of the best f...
A: ANSWER;- Correct answer is a,d,e
Q: Why is 80% ethyl alcohol is considered as the solvent of choice during phytochemical screening? What...
A: Note: As per Bartleby Guidelines, For Remaining Answers Please Repost The Question. Introduction: E...
Q: in your word, identify one difference one similarity between 16 S sequencing and metagenomic shotgun...
A: With the advancements in science, different techniques have emerged to sequence the genomes of organ...
Q: Pattern recognition receptors bind to Select one: a. B and T lymphocytes b. Host cell-associated mol...
A: Introduction Pattern Recognition Receptors are; Toll-like receptors (TLR) Nucleotide-binding oligom...
Q: Koch’s postulates
A: Robert Koch contributions were mostly in the field of disease-causing microbes. He gave Koch's postu...
Q: Please could you help me with these questions: Hair length of the fur in cats can be either short o...
A: Genetics is the study of genes and heredity, or how specific attributes or traits are passed down th...
Q: Give at least four types of food processing and explain its processes and applications.
A: Food Processing modification or changes to a plant or animal product after harvesting. Types of Foo...
What is the mostly used parts of the microscope during bacterial experiments and are their roles?
Step by step
Solved in 3 steps
- What common parts are found in both the compound microscope and stereo (dissecting) microscope?What is the difference between a scanning and a transmission electron microscope? When do you use each type?What is the purpose of compound light microscope? What is a compound light microscope and where did it orginate from?