You have a purebreeding line of blue frogs and a purebreeding line of red frogs.  You cross them and all the F1 frogs are purple.  You cross two of the F1 frogs to one another and get 1/4 red offspring, 1/4 blue offspring and 1/2 purple offspring.  What phenotypic ratio would you get if you crossed a purple frog to a red frog?

Q: What is the micro-climate zone of North Carolina?

A: Introduction: A microclimate is a small region within a larger area that has a different climate fro...

Q: Which of the definitions below most accurately describes a chromosome? Group of answer choices 1. P...

A: chromosome  Answer -  2. All of the DNA found in a cell

Q: The following items are ions: O Na+, NO2, H+ O CO2, K+, Ca+ Na+, H+, K+ СО2, Н20, NO2

A: The human body contains many ions such as sodium, potassium, calcium, chloride ions.  They are calle...

Q: The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1)...

A: Central Dogma: It is the complete procedure of replication, transcription, and translation of DNA. T...

Q: What are the importance of nitrogen and potassium in plants?

A: Plants need various nutrients in form of biomolecules for its activities , these elements are divide...

Q: Size of wattle, Shank spur (+/0), Shape of hackles, Shape of saddles, Size of tail feathers, and Sha...

A: Introduction :- Drosophila melanogaster is a fly species in the Drosophilidae family (taxonomic orde...

Q: While performing a routine protein crystallization screening, you observe that one of your well drop...

A: Introduction The drop on the elevated platform, which is usually 2–10 µl, consists of half stock pro...

Q: Jane is considering switching to a stricter vegan diet. You would suggest she pay attention to the p...

A: Answer- Option D. Minerals

Q: Examples of strategies found in structures in the human body that serve to increase the surface area...

A: Ans C  having folds. 

Q: C. Solve these problems by listing the given genotypes, test crosses, genotypic and phenotypic ratio...

A: Serrated leaf is a dominant feature in plants that is represented by the genotype(Aa Aa) whereas smo...

Q: What are some research-able questions about the Corona Virus?

A: Some research able questions about corona virus are listed below

Q: Fill in the blank. Words choice: • bud scales • nodes • apical meristem • axillary buds • internodes...

A: Angiosperm or flowering plants are the plants in which the seeds are embedded within the fruits. Thi...

Q: phylogenetic tree

A: A phylogenetic tree is a branching diagram or a tree showing the evolutionary relationships among va...

Q: Give 3 examples of a hormone and provide the following information of each hormone: a. where is the ...

A: According to the question, we have to provide 3 examples of a hormone and provide the following info...

Q: А D

A:

Q: Both Porifera and Placozoa possess epithelial tissues. True False

A: ''Since you have asked multiple question, we will solve the first question for you. If you want any ...

Q: Identify the pointed structures.

A: Connective Tissue is those tissues that support and protect the tissues and organs of the body. Some...

Q: can you explain me this slides how  to identify and labeled them

A: ANSWER;- The picture is the slide to identify and label them;-

Q: Which protein did you make? Give its name and tell what it does.

A: Proteins are important macronutrients and is present throughout body ( bones , hair , skin , muscles...

Q: What complication could arise from the biological synthesis of ceramide?

A: * ceramides composed of sphingosine and fatty acid. * They are mainly present in cell membranes with...

Q: Drag and drop the appropriate labels onto the cross section of the Cut Bank below the Highlevel/LRT ...

A: 6)River deposits. 5) vegetated berm  1)top soil(with brick)

Q: Explain the role of isotype exclusion in pro-B cells.

A: Introduction:- In a given lymphocyte, either κ or λ light (L) chain, but not both, can combine with ...

Q: Based on the pedigree, drag a claim about the inheritance pattern of sickle cell anemia into the app...

A: Sickle cell anemia : in this disease the RBCs become sickle shaped, due to which the WBCs attack on ...

Q: 3. Which line graph shows t@2 vehicle slowing down? Time (seconds)

A: In fig .1, given the distance versus time graph.From this speed of the vehicle at Every second is in...

Q: Why "cellulose is composed of a long, branced chain of B-glucose subunits" is false?

A: Introduction Polysaccharides, also known as polycarbohydrates, are the most common type of carbohydr...

Q: It all about flowering plants-use for asexual and sexual reproduction example Please help it is due ...

A: Sexual maturity is the age in which the reproductive organs mature and mating occurs. In context of ...

Q: what are the function(s) of the major organelles in the animal and plant eukaryotic cell?

A: Organelles are specialised structures found inside cells that perform a variety of tasks. "Little or...

Q: Differentiate the following

A: Cytoplasm is a thick solution which fills each cell and is enclosed by the cell membrane.

Q: Two pea plants are crossed, which are purebred. A father is round, terminal, violet and wrinkled, wh...

A: Genetics is the science that deals with the inheritance of the genes or characters from one generati...

Q: What was the only conclusion that John Cairns could draw from his 1963 paper "The bacterial chromoso...

A: Introduction :- Escherichia coli (E. coli) is a type of bacteria that dwells in the intestines of bo...

Q: Which of the following best describes an emergent property? Group of answer choices a property that...

A: The organ system is a very complex creature made up of several systems. Each system in the body has ...

Q: Describe what forensic pathologist is and the determination of the causes and manners of death in a ...

A: Introduction: Forensic pathology, forensic psychiatry, forensic dentistry, forensic radiology, and f...

Q: What is the major function of the Parathyroid glands?

A: Introduction;  Parathyroid glands are actually 4 pea sized endocrine gland located on the posterior ...

Q: Which type of virus must contain an RNA replicase packaged in the viral particle in order to carry o...

A: A virus is a small collection of genetic code, it can be  DNA or RNA, surrounded by a protein coat ,...

Q: How does application of recombinant DNA influenced the way in today's life? Answer comprehensively

A: Recombinant DNA technology is an important development in science that has made human life much easi...

Q: 13. A peripheral membrane protein is best described as a protein a. embedded within the phospholipid...

A: INTRODUCTION Answers of question 13-15 is given below.

Q: Refer to the above diagram to answer the question. a) Which group is most closely related to humans....

A: Humans are classified as primates and are members of the Hominidae (Great Ape) family on the broader...

Q: Infants with Tay-Sachs disease appear normal at birth, but begin to deteriorate by about 6 months of...

A: Introduction :- Tay-Sachs disease is a rare neurodegenerative ailment in which a lack of an enzyme (...

Q: Sponge archeocytes can differentiate into A. eggs (oocytes) B. sperm C. choanocytes D...

A: Sponges are organised at a cellular level. They don't have any features that may be classified as or...

Q: A DNA probe with sequence TCAGGCTTCAG would bind most strongly to which of the following DNA fragmen...

A: DNA probes are single-stranded DNA segments that are hybridised to indicate the existence of complem...

Q: How are animal cell tight junctions and desmosomes (aka adhesion junctions) different?

A: Tight junctions form a water tight seal and prevent material from passing between cells. Desmosomes ...

Q: What is the role of a virus in gene therapy? O t carries the faulty DNA out of the patient's cells. ...

A: Given: Much attention has, been focussed on the so called genetic metabolic diseases in which a defe...

Q: You mix a few drops of a patient’s blood with ABO and Rh typing serums (antibodies against A, B, & R...

A: Introduction The presence of particular antigens, or blood group components, on human red blood cell...

Q: If the parent diploid cell starts with 12 Chromosome and undergoes mitosis, then how many will the d...

A: Cell division is a process by which cells multiply themselves and it involves both cytoplasmic and n...

Q: what are the factors affecting visual perception of humans?

A: Visual perception is the ability to interpret the surrounding environment through photopic vision (d...

Q: Draw the bond-line structure of the given peptides. 1. Ser-Asp 2. Glu-Gln 3. Arg-His

A: Bond line structure of the amino acids reveals the covalent bonding, hydrogen bonding and peptide li...

Q: List atleast 50 laboratory equipments or tools. Just list, no need to give the uses

A: ANSWER;-  50 laboratory is;-  

Q: Which of the following hierarchy of life levels are not correct? Group of answer choices 1. Molecul...

A: Life has evolved from simpler cells to complex multicellular organisms. This is also evident as the ...

Q: Explain the roles of the sensory nerves in how do humans experience pain and tickling sensation?

A: Sensation is the ability of our body to feel things especially physical touch. It is the result of s...

Q: Fill in the blank with the most appropriate term that is described by the following statemer Synthes...

A: During DNA replication, an RNA primer serves as a starting point for DNA polymerase , which builds c...

Inheritance and Mendelian Genetics

Inheritance means the passing of traits to offspring from parents. These traits could be passed either through asexual reproduction or sexual reproduction. The offspring receives the genetic material from the parents. Mendelian inheritance is a certain biological inheritance that follows the rules and principles laid down by Gregor Mendel in 1865. The initial hypothesis was considered wrong, but other inheritance theories modified the concept of inheritance and thus genetics.