12 python Question 12What is the output of the following?x = {"apple", "banana", "cherry"}y = {"google", "microsoft", "apple"}x.intersection_update(y)print(x){"apple", "banana", "cherry"}{"apple", "banana", "cherry", "google", "microsoft" }{"apple", "banana", "cherry", "google", "microsoft", "apple" }{'apple'}

Dear Student, The output of the code is {'apple'}. This is because the intersection_update method…

Answered: What is the output of the following? x…

What is the output of the following? x = {"apple", "banana", "cherry"} y = {"google", "microsoft", "apple"} x.intersection_update(y) print(x)

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Similar questions

In this final submission, you will build on checkpoint B to load the database and DNA sequence from files. There will be two databases and several sequences that will be available for download below. Example of the database is the file small.txt: name,AGATC,AATG,TATC Alice,2,8,3 Bob,4,1,5 Charlie,3,2,5 Example of the sequence is the file 1.txt: AAGGTAAGTTTAGAATATAAAAGGTGAGTTAAATAGAATAGGTTAAAATTAAAGGAGATCAGATCAGATCAGATCTATCTATCTATCTATCTATCAGAAAAGAGTAAATAGTTAAAGAGTAAGATATTGAATTAATGGAAAATATTGTTGGGGAAAGGAGGGATAGAAGG Implement/modify the following functions: Modify the function readData, which will now take an additional parameter: a string representing the filename containing the database of individuals and their STR counts. It will also return a bool indicating if opening the file was successful or not: bool readData(string filename, vector<string>& nameSTRs, vector<string>& nameIndividuals, vector<vector<int>>& STRcounts) Update the function…
can you provide assumptions and demonstration for this code?? only C programming #include <stdio.h>#include <stdlib.h>#include <string.h> // Function Declarationsvoid create_inventory();void update_vacc_qty();int search_vaccine();void display_vaccine(); // Main Function starts here int main(){create_inventory();display_vaccine();search_vaccine();//update_vacc_qty();return 0;} //Function to Create Vaccine.txt as per the given tablevoid create_inventory(){int option = 1;// variables to collect data as per table givenchar vaccinename[15];char vaccinecode[2];char country[15];int dosage;float populaion; //File definitionFILE* infile;infile = fopen("Vaccine.txt","w"); // file opening for writingif (infile == NULL) // Checking for the file creation{printf("Vaccine.txt file unfamiliar\n");} //Accepting data from user from keyboard till user enters 0 to closewhile (option != 0){printf("Enter Vaccine Name : ");scanf("%s", vaccinename);printf("Enter Vaccine Code : ");scanf("%s",…
34- Consider the following assignment statement: price = 2.99 Which of the following options most accuractely describes what happens when the statement is executed? a. The object 2.99 is placed in memory, and the variable price references that object. b. The program crashes because double equals (==) must be used for assignment. c. The object 2.99 is placed in memory, and then copied into the variable price. d. The object 2.99 is placed in memory but immediately becomes inaccessible since there are no references to it.
My code here is in Python and the goal is to create a BankApp where the user is suppose to enter their username and password and its suppose to show the balance but I forgot to add the information that is suppose to be implemented in my code as shown below. userName passWord Balance========================Mike sorat1237# 350Jane para432@4 400Steve asora8731% 500 Its also suppose to do down the following. Type D to deposit moneyType W to withdraw moneyType B to display BalanceType C to change user, display user nameType A to add new clientType E to exit My Code def read_user_information(): usernames = [] passwords = [] balances = [] try: with open("UserInformation.txt", "r") as file: lines = file.readlines() for line in lines[2:]: data = line.strip().split() usernames.append(data[0]) passwords.append(data[1])…
The image below is the assignment, and above that is the code written to solve it...Please explain each step to me with "//" !! using System.IO;using System;class Program{ static void Main(){ double [] lst = new double[5]; int i= 0, m; while (i < 5){ Console.WriteLine("Please enter the number(10-100)"); lst[i]= Convert.ToDouble(Console.ReadLine()); if(lst[i]<10 && lst[i]>100){ Console.WriteLine("The number is outside the range"); break; } int dpc = 0; for (int k = 0; k < i; k++) { if (lst[k] == lst[i]) { Console.WriteLine("Please don't enter duplicates"); dpc = 1; break; } } if(dpc==0) i++; } Console.WriteLine("The entered numbers are below"); for(m=0;m < 5;m++) Console.WriteLine(lst[m]);…
Question 40. Consider the following code chunk: import random x=0while(x < 4): x = random.choice([1, 2, 3]) print(x) It is not a good idea to run these lines because...a) x is an invalid argument to print().b) the condition x < 4 is never violated.c) the function random.choice() does not exist. d) x is initialised with the wrong type.
Question 10 Which statement of the following is the most appropriate? Group of answer choices In C++, the allo operator is used to allocate dynamic memory. The delete operator is used to free dynamic memory. In C++, the new operator is used to allocate dynamic memory. The delete operator is used to free dynamic memory. In C++, the new operator is used to allocate dynamic memory. The clean operator is used to free dynamic memory. In C++, the allo operator is used to allocate dynamic memory. The clean operator is used to free dynamic memory.
Hello, I am having an error and cannot figure out how to solve this question. Could someone please assist? Please be advised, I am using PostgreSQL as that is what was used in class. Thus, I must use PLPGSQL Code CREATE OR REPLACE FUNCTION Moreno_03_bankTriggerFunction()RETURNS TRIGGERLANGUAGE PLPGSQLAS$$CREATE TRIGGER Wise_12_bankTriggerAFTER DELETE ON accountFOR EACH ROW EXECUTE PROCEDURE Moreno_15_bankTriggerFunction();
## I NEED HELP GETTING THIS PYTHON CODE TO FUNCTION PROPERLY## class Patient: def _init_(self,fname,mname,lanme,zipcode,phone,addess,city,state): self.firstName = fname self.middleName = mname self.lastName = lanme self.zip = zipcode self.phoneNumber=phone self.add = addess self.city = city self.state = state def _str_(self): return "Name: " +self.firstName+ " "+ self.middleName +" "+self.lastName+"\n"+"Address: "+self.add+" city: "+self.city class Procedure: def _init_(self, procedure, date, practitioner, charges): self.procedureName = procedure self.procedureDate = date self.practitionerName = practitioner self.charg = charges def _str_(self): x= float(eval(str(self.charg))) return "Procedure Name: "+ self.procedureName+"\nDate: "+ self.procedureDate+"\nPractioner: "+ self.practitionerName+ #Patient Objecct patient1 =…
9.4 Full explan please
A teacher is compiling data and needs to find the number of B grades. A B grade is any score greater than 79 and less than 90. If the data is listed in B1 through B210, which function would count the grades correctly? a. =COUNTIFS(B1:B210,>79,B1:B210,<90) b. =COUNTIF(B1:B210,">79") c. =COUNTIFS(B1:B210,">79",B1:B210,"<90") d. =COUNTIFS(B1:B210,">79","<90")
You are required to make changes in the below programs and introduce the use of compaction where required. FIRST-FIT #include<stdio.h> #include<conio.h> #define max 25 void main() { int frag[max],b[max],f[max],i,j,nb,nf,temp; static int bf[max],ff[max]; clrscr(); printf("\n\tMemory Management Scheme - First Fit"); printf("\nEnter the number of blocks:"); scanf("%d",&nb); printf("Enter the number of files:"); scanf("%d",&nf); printf("\nEnter the size of the blocks:-\n");for(i=1;i<=nb;i++) { printf("Block %d:",i); scanf("%d",&b[i]); } printf("Enter the size of the files :-\n");for(i=1;i<=nf;i++) { printf("File %d:",i); scanf("%d",&f[i]); } for(i=1;i<=nf;i++) { for(j=1;j<=nb;j++) { if(bf[j]!=1) { temp=b[j]-f[i]; if(temp>=0) { ff[i]=j; break; } } } frag[i]=temp; bf[ff[i]]=1; } printf("\nFile_no:\tFile_size :\tBlock_no:\tBlock_size:\tFragement"); for(i=1;i<=nf;i++) printf("\n%d\t\t%d\t\t%d\t\t%d\t\t%d",i,f[i],ff[i],b[ff[i]],frag[i]); getch(); }