What is the size range for most typical bacteria? Both of these are correct 200-2000 nanometers x 2000-8000 nanometers O Neither of these is correct 0.2-2.0 micrometers x 2.0-8.0 micrometers
Q: Why are environmental factors important to epigenetics? They intervene in genetic codes containing…
A: Introduction : The process of epigenetics involves modifications to the way that genes work and are…
Q: Choose one biomechanical principle that you will need to keep in mind while performing each exercise…
A: Motion, force, momentum, levers, and balance are the five main elements in biomechanics: Motion is…
Q: 3. Name nonessential structural elements of bacteria and their functions
A: Introduction :- Nonessential structural elements of bacteria are components of the bacterium that…
Q: 5) Humans who have an abnormally high level of cholesterol are said to suffer from familial…
A: Introduction :- Familial hypercholesterolemia is an inherited disorder characterized by elevated…
Q: What biomolecule are promoters and enhancers composed of?
A: Biomolecules are organic compounds present inside the cells of the living organism. Protein, lipids,…
Q: Draw the three different cell junctions, and explain how the structure of one of these junctions…
A: In tissues, cells are connected to one another via cell-cell junctions, which also control tissue…
Q: ’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ Fill in the complimentary DNA strand and…
A: Watson and Crick elucidated in 1953 , the famous double stranded structure of the DNA molecule and…
Q: 27 a.) which of the following are both forces of evolution 1. Selection and Mutation 2. Selection…
A: Introduction: A) Evolution is the process by which populations of organisms change over time in…
Q: INSTRUCTION: - Answer the question properly - Discuss your answer - Do not copy in Google or here in…
A: The following question asks for a description of a hypothetical fossil of a whale skull and its…
Q: What are advantages and disadvantages of asymmetrical body plan in animals?
A: INTRODUCTION Asymmetrical bodies are a unique type of physique that is characterized by having a…
Q: natural selection that leads to evolution of phenotypic differences A. Stabilizing selection…
A: Natural selection is the process by which species change over time as a result of environmental…
Q: Imagine three islands, each with a population of frogs. There are approximately 1,100 frogs on…
A: Introduction :- Genetic drift is a random process that can result in changes to the genetic…
Q: Sodium concentration in extracellular fluid is: O > potassium < potassium = potassium undetectable
A: When compared to only 5 g of iron and 0.06 g of copper, a typical human weighing 70 kg has…
Q: Can Mendelian genetics explain blood type? Why or why not?
A: Mendelian genetics, named after the 19th-century Austrian monk Gregor Mendel, is a type of genetic…
Q: Which event occurs in the first stage of labor? The placenta separates from the uterine wall. The…
A: Labor involves a cascade of events that triggers uterine contractions to deliver the developed baby…
Q: For the following traits, what information must you have in order to predict the phenotype of an…
A: Answers : A. The maternal influence can be seen in the coiling of snails. When there is a maternal…
Q: Sort the following events to reflect the order in which they should occur during vesicle docking…
A: Answer correct option (b) 3124 Vesicle have bounded Rab-GTP which interacts with Rab effector…
Q: The carbon cycle is nature’s way of reusing carbon atoms, which travel from the atmosphere into…
A: The carbon cycle is a natural process that involves the exchange of carbon between the atmosphere,…
Q: Choose which one Hypotonic, Hypertonic, Isotonic
A: Introduction: The cell membrane, also known as the plasma membrane, is a thin, semi-permeable…
Q: 1. In the Hardy-Weinberg equation, what do the terms p², q², and 2pq represent, in terms of the…
A: Evolution is the process by which species of living organisms change and diversify over time through…
Q: For each of the following amino acids: 1) describe what the important functional group of the amino…
A: Proteins are made up of amino acids. Each amino acid has a distinct side chain, also referred to as…
Q: Phenotype Genotype Dominant Recessive Diploid III III |||| E A trait that can be expressed from only…
A: Introducion Genetics is a branch of science that deals with the study of genes, genetic variation…
Q: INSTRUCTION: - Answer the question properly - Discuss your answer - Do not copy in Google or here in…
A: Figure 1 depicts the close likeness of Janjucetus hunderi teeth (a-d) and those of the currently…
Q: Which statement is true about fetal alcohol syndrome? It is on the mild end of the disability…
A: The disorder known as fetal alcohol syndrome affects children who were exposed to alcohol while…
Q: What occurs as a result of the joining of sperm and ova? gametes meiosis mitosis zygotes
A: A sperm cell and an egg cell fusing together to create a single cell that contains the genetic…
Q: Aunt Smiley has the cutest pointed ears (Pp) and would love to have all her children with pointed…
A: Introduction :- Genetics plays a crucial role in determining the characteristics of an offspring.…
Q: It has been a really bad day at the hospital. The maternity ward staff has mixed up four female…
A: There are mainly four types of blood groups which A,B,AB and O based on the presence of antigens and…
Q: The pedigree below shows the inheritance of the rare blistering disease (epidermolysis) in dogs.…
A: Introduction A gene exists in two alternative forms called allele. If both the alleles of a gene is…
Q: ) List the different levels of the taxonomic classification system, in the order of most inclusive…
A: Introduction: The taxonomic classification system is a hierarchical system used to categorize and…
Q: Mendelian genetics
A: Biological inheritance: The process of passing of characters from parent to the offspring (i.e.,…
Q: The cells of sexual reproduction genes chromosomes gametes zygotes are called
A: Sexual reproduction is the process of creating new organisms by combining the genetic information of…
Q: Types of substance transports through the membrane: secondary active transport (mechanism and…
A: Introduction :- Secondary active transport is a type of transport across biological membranes that…
Q: 30. Which of the following statements are correct regarding a nucleosome? a.) contains an octamer…
A: Introduction A nucleosome is the basic unit of DNA packaging in eukaryotic cells. It is composed of…
Q: What came first, the ribosome or the protein? explain in detail why
A: Ribosomes are essential components of cells, responsible for synthesizing proteins from the…
Q: CELL MEMBRANE VOCABULARY TERMS LIST Use the terms below to fill in the blanks. Cell membrane Lipid…
A: Cell is structural and functional unit of all organisms. The cell was discovered by Robert hooke in…
Q: What is the purpose of: A. The concentrated salt solution? B. adding isopropyl alcohol to the…
A: Introduction: DNA extraction is a process in which the DNA is separated from other cellular…
Q: 9. Identify the TRUE statement about the process of transcription: * ORNA polymerase requires an RNA…
A: Translation and transcription are key molecular processes that occur in all cells. They are the…
Q: a. The monomer b. The monomer c. The monomer of a of a nucleic acid is called: ANSWER of a protein…
A: Introduction Macromolecules are large, complex molecules that are essential to the function and…
Q: Tetraethylammonia, a toxin that blocks potassium channels, will More than one answer may be…
A: Introduction : There are three phases of action potential. These are depolarisation, repolarisation…
Q: The amino acid sequence of this short protein (from the N-terminus to C-terminus) is shown below:…
A: Every three nucleotides in DNA correspond to three nucleotides in RNA. The three RNA nucleotides…
Q: Parents purple x purple red x blue white x white red x white precursor 1 precursor 2 he pathway…
A: Enzymes are responsible for a certain pathway to be carried on. In this various precursors are…
Q: In photosynthesis, which of the following is NOT true about the light-dependent (“light”) reaction?…
A: Plants and other living things having chlorophyll employ a process called photosynthesis to…
Q: Which one of the following is NOT a characteristic of prokaryotic cells? Cytoplasm.…
A: INTRODUCTION The oldest single-celled microbes on Earth are prokaryotic cells. Bacteria and archaea…
Q: The four daughter cells produced in meiosis Multiple Choice each has one-fourth the number of…
A: Introduction :- The cell division process known as meiosis creates four gamete cells while cutting…
Q: Explain why the phenotypic frequency of the tuskless trait is increasing in the African elephant…
A: The change in the character of an organism over generations is called evolution. The evolution of…
Q: How does DNA bending protein relate to transcription?
A: Introduction: Binding to their recognition site, a growing number of transcription factors from…
Q: Label the anatomy of the female. Vagina Anus Labia minora Ampulla Infundibulum Ovary Labia majora…
A: The female reproductive system is a series of organs in the female body that are involved in the…
Q: What are mitosis and meiosis? These two processes are how parent cells produce daughter cells.…
A: Cell division is the process by which cell divides to produce daughter cells. There are two types of…
Q: at ed $ 7) a 8) Describe one example of diffusion in the human body. In your description be sure to:…
A: Insulin/Glucagon Diffusion- • We have modeled the rate of insulin and glucagon secretion at the…
Q: A 16-square Punnett is time-consuming to draw out. Dr. Thompson can easily solve this problem by…
A: A Punnett square is a graphical representation used in genetics to predict the probability of an…
Step by step
Solved in 2 steps
- A microbiologist is working with a pure strain of bacteria isolated from a mixed sample. Which of the following would indicate that the bacterium is NOT Helicobacter pylori? Cells have flagella when viewed by flagellar staining. Secretes acids produced from metabolism of sucrose. Cells are curved rods. Produces and secretes urease enzyme. Cells stain Gram negative.write out a detailed summary on E.Coli. Questions below will help yu frame your summary. Please describe the bacterium. What is its shape and size? Is it Gram-positive or negative? Pictures are always fun! If you can find a microscopic image – include it. What is/are the reservoir(s)? e.g. water, food, human, etc. Are there parameters needed for infection? (Temperature, pH) What is/are the mode(s) of transmission. If it's foodborne - is it linked to a specific food? How many cases occur each year? In the US and/or worldwide and/or in the County where you live Has it caused any outbreaks or epidemics? Thank you-Bacteria in the phylum Firmicutes are distinguished from the phylum Actinobacteria on the basis of their spiral shapes. the presence of LPS in their membranes. their Gram stain reaction. the low G + C content of their DNA. the high G + C content of their DNA.
- A microbiologist is working with a pure strain of bacteria isolated from a mixed sample. Which of the following would indicate that the bacterium is NOT Streptococcus mutans? Cells are arranged in chains. Secretes acids produced from metabolism of sucrose. Cells are cocci. Can grow in biofilms. Cells stain Gram negative.Assume that after washing your hands, you leave ten bacterial cells on a new bar of soap. You then decide to do a plate count of the soap after it was left in the soap dish for 24 hours. You dilute 1 g of the soap 1:106 and plate it on heterotrophic plate count agar. After 24 hours of incubation, there are 168 colonies. How many bacteria were on the soap? How did they get there?i am responsible for detrmining how many bacteria are in a 100ml sample of milk. 1 pour 1 ml of my sample onto a plateof nutrient agar and incubate the plate at 37 degrees to 48 hrs. when i come back to the labi count 295 colonies. how many cells were in my original 100 ml sample of milk?
- Which of the following is not true or related to bacterial capsule formation A. Rigid and attached tightly to the cell wall B. Loose and weakly associated with bacterial cell wall. C. Capsule formation is associated with virulence of pathogenic bacteria D. Capsule provides resistance to survive through harsh conditionsPls can you identify this organism The first picture is gram stain negative The second pictures is endospore stainAnswer the following questions: 1. Define a bacterial colony. 2. What is the difference between macroscopic and microscopic appearance of bacteria? 3. State the three standard terms used to describe single colonies on agar plates. 4. State and define the three types of growth that may be seen in a broth culture. 5. State three basic shapes of bacteria. 6. State and describe the different arrangements of cocci. 7. What is the difference between true motility and Brownian motion?
- Which of the following statement/s is/are true about gram negative bacteria Cell wall has thin peptidoglycan layer Cell wall lipid content is very low Lipopolyscharride layer is present All of the aboveExamine the image below. The bacteria in this image have been treated with gram straining procedure. Indicate the following information A. Shape ........; Gram stain ( Gram (+), Gram (-) or both ... B. Stained color under microscope..... . C. Is the PG wall think, thin or both ..Which of the following is NOT a characteristic for bacteria in general? Plasma membrane has no saccharide units Sterols is one of its major outer membrane component Genome present in the nucleiod region of the cytosol Granules are mostly polysaccharide in nature