What mRNA is transcribed from each DNA sequenа. 5'-GTTCTAС-3'3'--5'b. 5'-ATTTGAAA-3'3'--5'c. 5'-GCCTAAGGCT-3'3'--5'd. 5'-CGCGCTTTGTG-3'3'--5'

Name: What mRNA is transcribed from each DNA sequenа. 5'-GTTCTAС-3'3'--5'b.
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: What mRNA is transcribed from each DNA sequenа. 5'-GTTCTAС-3'3'--5'b. 5'-ATTTGAAA-3'3'--5'c. 5'-GCCTAAGGCT-3'3'--5'd. 5'-CGCGCTTTGTG-3'3'--5'

The method of constructing an RNA copy of a genetic sequence is known as transcription. That copy,…

Answered: What mRNA is transcribed from each DNA…

Science

Biology

What mRNA is transcribed from each DNA sequen а. 5'-GTTCTАС-3' 3'- -5' b. 5'-ATTTGAAA-3' 3'- -5' с. 5'-GCCTAAGGCT-3' 3'- -5' d. 5'-CGCGCTTTGTG-3' 3'- -5'

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter9: From Dna To Protein

Section: Chapter Questions

Problem 11SA: _______ are removed from new mRNAs. a. Introns c. Poly-A tails b. Exons d. Amino acids

See similar textbooks

Similar questions

A promoter is ______. a. a specific sequence of DNA nucleotides b. a specific sequence of RNA nucleotides c. a protein that binds to DNA d. an enzyme that synthesizes RNA
C. Convert the DNA template to mRNA. Then, convert the mRNA to tRNA. Based from the resulting sequence in the anticodons of tRNA, determine the appropriate Amino acid sequence that will be synthesized. Refer to the genetic code. 1. DNA Template: TAC - GGC - TAC - CAT - ATG - GAG mrNA: tRNA: Amino acid sequence: 2. DNA Template: TTA - CAT - CAT - ATC - GAT - GAC mrNA: tRNA: Amino acid sequence: 3. DNA Template: CTA - GCG - ATA - AAA - TTT - ATT mrNA: tRNA: Amino acid sequence:
(a) Write the complementary base sequence for the matching strand in the DNA section shown below:. 5’ – A T G T T A C T A G T C – 3’ (b) The following section of DNA is used to build an mRNA for a protein: 3′—AAG—CTT—CTC—5′. What is the corresponding mRNA sequence?
A single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a) Imagine that AAG is an INTRON in the original DNA template strand above. Write the mature mRNA strand after the three modifications? b) Write the amino acid sequence of your mature mRNA. c) List the molecules involved in translation and briefly describe their function.
Considering the given sequence of nucleotides in an mRNA molecule, (a) what is the sequence of the DNA template strand from which the RNA was synthesized? (b) What peptide is synthesized by this mRNA sequence? 5' GAG CCC GUA UAC GCC ACG 3'
Where does mRNA/tRNA codon-anticodon recognition take place? a)40S b)50S c)The surface between the two ribosomal subunits d)30S
A single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a) Using the same strand above as a template, write the pre-mRNA transcript. b) List the molecules that must be present for DNA to be transcribed. Briefly describe their function. c) What are three modifications that happen to pre-mRNA before it becomes mature mRNA
Considering each nucleotide sequence in an mRNA molecule: [1] write the sequence of the DNA template strand from which the mRNA was synthesized; [2] give the peptide synthesized by the mRNA. a. 5 ' UUG CUC AAC CAA 3 'b. 5 ' AUU GUA CCA CAA CCC 3
Which two sequences shown in the diagram are NOT directly transcribed from the template strand of DNA for this mRNA? ( select all that apply) a) The exons b) 5' cap c) 3' poly-A tail d) UGA e) AUG
Examine the following sequence of DNA3’-CTA – TAC – TTA – CGC – GTA – CAT – GCG – TGA – CCC - ACG – ACT – AGG-5’Write out the complementary DNA sequence (identify 3’ and 5’ ends)Write out the complementary mRNA sequenceWrite out the peptide sequence this DNA encodes
During the transcription of DNA to mRNA, __________. Group of answer choices a) RNA polymerase moves along the DNA (reads) in the 5’ to the 3’ direction b) the 3’ end of the mRNA molecule is produced first c) RNA polymerase must first bind to a promoter sequence d) transcription is initiated at a “start codon”
Here is the nucleotide sequence of an imaginary strand of DNA: 5’ AATTGGCCATGC 3’. If this strand of DNA was transcribed, the resulting messenger mRNA molecule would be: Met-Val-Tyr-Lys 3’ TACGTACG 5’ 3’ TTAACCGGTACG 5’ 3’ UUAACCGGUACG 5’