During the transcription of DNA to mRNA, __________. Group of answer choices a) RNA polymerase moves along the DNA (reads) in the 5’ to the 3’ direction b) the 3’ end of the mRNA molecule is produced first c) RNA polymerase must first bind to a promoter sequence d) transcription is initiated at a “start codon”

During the transcription of DNA to mRNA, __________. Group of answer choices a) RNA polymerase moves along the DNA (reads) in the 5’ to the 3’ direction b) the 3’ end of the mRNA molecule is produced first c) RNA polymerase must first bind to a promoter sequence d) transcription is initiated at a “start codon”

Name: During the transcription of DNA to mRNA, __________.Group of answer ch
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: During the transcription of DNA to mRNA, __________.Group of answer choicesa) RNA polymerase moves along the DNA (reads) in the 5’ to the 3’ directionb) the 3’ end of the mRNA molecule is produced firstc) RNA polymerase must first bind to a promoter

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter9: From Dna To Protein

Section: Chapter Questions

Problem 16SA

See similar textbooks

Similar questions

Complete the phrases with the correct word or words. The task is to match the lettered items with the correct numbered items. Appearing below is a list of lettered items. Following that is a list of numbered items. Each numbered item is followed by a drop-down. Select the letter in the drop down that best matches the numbered item with the lettered alternatives. a. methionine b. ribosome c. codon d. AUG e. UAC The mRNA moves out of the nucleus and attaches to a The first codon of an mRNA molecule is always As soon as the first codon is in place, a tRNA molecule arrives with the anti-codon The first tRNA to arrive always carries the amino acid called, The ribosome scoots along the mRNA to read the next
The following is a section of DNA removed from a cell nucleus:5' ATGAAATAATCAGTTAACAGCAGVFCCGATTTTTATACT 3'strand 3' TACITTATTAGTCAAVFGTCGTCAAGGCTAAAAATATGA 5'strand a. What does the Central Dogma state? b. Label the strands above as the "sense" or "antisense" strand. c. Using the chart below, transcribe ONLY the gene into mRNA and then translate the gene into its amino acid sequence, d. What would happen to the gene if the adenosine mutates to a thymine where the arrow indicates? 3' TACTTTATTAGTCAATTGTCGTCAAGGCTAAAAATATGA 5' What type of mutation is this?
If the sequence of an mRNA is GAGUUCACAGUAGGC, the sequence of the template strand of the corresponding gene is... which of the following answers? a. CTCAAGTGTCATCCG b. GCCTACTGTGAACTC c. 3' GAGTTCACAGTAGGC 5' d. GAGTTCACAGTAGGC e. none of the above
Write a paragraph about transcription, and include the following terms: transcription factors, promoter region, TATA box, RNA polymerase, elongation of RNA, and terminator sequence. DNA sense vs. nonsense strand and 5’ ends. And please include one image of what is happening.
Match Column A with Column B. transports amino acids to the site of protein synthesis has anticodon loop directs amino acid sequence of proteins contains the Shine-Delgarno sequence synthesized in the eukaryote nucleus found inside the ribosome region where the RNA binds to the DNA template…
Number the following steps of protein synthesis in the order in which they occur, starting with 1 and ending with 9.a. _____ The stop codon is reached, and the polypeptide is released.b. _____ The small ribosomal subunit finds the start codon, and the large ribosomal subunit joins.c. _____ The end of the gene is reached, and the pre-mRNA is released and then edited.d. _____ The transcription factor binds the promoter.e. _____ The protein is folded and modified to become functional.f. _____ RNA polymerase builds the mRNA transcript.g. _____ mRNA and initiator tRNA bind the small ribosomal subunit.h. _____ New tRNA molecules are brought into the A site successively, and the peptide chain of the tRNA in the P site is joined to the amino acid of the tRNA in the A site.i. _____ mRNA exits the nucleus via a nuclear pore.
Please choose the correct answer. Which of the following statements is NOT true about reverse transcription? a. A tRNA primer initiates reverse transcription. b. The second DNA strand begins at the polypurine tract. c. Reverse transcriptase degrades the copied RNA segment. d. Circularizing the DNA allows completion of the second DNA strand.
Number the following steps of protein synthesis in order in which they occur, starting with 1 and ending with 9. a. ____ the stop codon is reached, and the polypeptide is released b.____ the small ribosomal subunit finds the start codon, and the large ribosomal subunit joins. c.____ the end of the gene is reached, and the pre-mRNA is released and then edited. d. ____ The transcription factor bonds the promoter. e. ____ the protein is folded and modified to become functional. f. ____ RNA polymerase builds the mRNA transcript. g. ____ mRNA and initiator tRNA bind the small ribosomal subunit. h. ____ new tRNAs are brought into the A site successively, and the peptide chain of the tRNA in the P site is joined to the amino acid of the tRNA in the A site. i. ____ mRNA exits the nucleus via a nuclear pore.
Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
Briefly describe the function of the following in protein synthesis. a. rRNA b. tRNA c. mRNA
Put the following processes in order of their occurrence during expression of a eukaryotic gene: a. mRNA processing c. transcription b. translation d. RNA leaves nucleus