What organism is usually observed when studying the blastula and gastrula stages?

Q: describe the events that occur over the 6 day period following fertilization of an ovum

A: An ovum or egg is the female gamete of an individual. It can fertilize with the male gamete to form…

Q: What is the main approaches of genetics?

A: Genetic research has advanced considerably over the last few decades to improve human health. This…

Q: Choose the correct answer Q1: The forelimb of humans, dogs, birds, and whale are similar in the set…

A: 1) When a number of structures from organisms of different species have same basis structure like…

Q: Q1: Variable descriptions of a character is called a _____________.  A. Homologous character B.…

A: Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: Active immunity is acquired over the course of a lifetime by exposure to antigens. Describe the two…

A: Immunity and immune system Immunity is the ability of the body to fight against consequences caused…

Q: Given the DNA strand with sequence 5' AUGGAGGAUGGCCAGUCAAUUUGA 3' match the various mutations to the…

A: Codon is a sequence of three nucleotides that corresponds to a specific amino acid. Codons encode…

Q: number 32

A: Linked genes  The genes are said to be linked if they are tend to pass together in sperm of egg.

Q: The following results were obtained from a disk diffusion test for microbial susceptibility to…

A: Zone of inhibition of an antibiotic shows its effectiveness. It is termed as the area or space where…

Q: Please answer fast Explain the difference between aerial and basal grass tillers.

A: Answer-

Q: Using the 5 major steps, make or create your own flow diagram of the genetic engineering process…

A: Flow diagram of genetic engineering process.

Q: The hormone mechanism which results in the release of intracellular Ca++ is the:   Question…

A: Introduction Signals received by receptors at the cell surfaces are relayed throughout the cell via…

Q: In addition to anaerobic bacteria which other two examples did the narrator state that anaerobic…

A: Here I will give the two other conditions or states of anaerobic conditions.

Q: Choose the correct answers. Q1: It is a practice of making hypotheses about taxonomic…

A: DISCLAIMER "Since you have asked multiple questions, we will solve the first question for you. If…

Q: Identify the Shannon diversity index in the two hypothetical communities below. Which of the two…

A: Shannon diversity index or Shannon-Wiener diversity index is commonly used to characterize species…

Q: How many accessory and guard cells are found in one stomatal complex of the specimen?

A: Since you have posted multiple questions we will solve the first question for you. If you want any…

Q: Match the parts of the brain with their functions: A. cerebrum B. pons C. pineal body D. medulla…

A: The brain has three fundamental parts: the cerebrum, cerebellum, and brainstem. The cerebrum is the…

Q: ers from polymerizing totally into filaments? explain.

A: Actin filaments- These are the polar structures which are composed of globular molecules of actin…

Q: What are ferns? Describe its salient features.

A: A pteridophyte is a type of vascular plant that spreads spores. Pteridophytes do not produce flowers…

Q: What are ferns? Describe its salient features.

A: Introduction Ferns:- The ferns are also referred to as Polypodiophyta, The word “Pteridophytes”…

Q: before each nutrient can be absorbed it is broken down into its smallest component.  What are the…

A: The food contains three macronutrients that require digestion before they can be absorbed. The three…

Q: . What is the major reason why the maize genome is muchlarger than the rice genome?a. Maize has more…

A: A genome is all of a living being's hereditary material, according to molecular science and…

Q: f you have otoliths from two fish of the same species and they are the same shape but different…

A: In fish, otoliths are biomineralized ear stones that help in hearing and vestibular function. The…

Q: all of the following that are true regarding viruses? Oncogenic viruses stimulate uncontrolled host…

A: All that are true regarding viruses -  Answer - 1. Oncogenic viruses stimulate uncontrolled host…

Q: following data could the man be the father of the 3 children? please write complete answer and…

A: * Given that father has genotype Dce/DcE/Ms/NS this is 0 type blood group. * Mother has genotype…

Q: O Variolation had high infectious (10%) and death rates (up to 3%). Vaccination was much safer and…

A: INTRODUCTION  Variolation was an old method used for immunize infected persons against some deadly…

Q: A tropism in response to seasonal changes is associated with a. heliotropism b. phototropism c.…

A: Tropism is a phenomenon when plant shows its growth or development or change its curvatures upon…

Q: What are some of the advantages and disadvantages of utilizing insects as experimental animals in…

A: Insects are one of most commonly used experimental model which helps in various ways in clinical and…

Q: Describe the similarities in sexual reproduction of moss and fern.

A: The similarities in sexual reproduction of moss and fern are:

Q: You are given the following carbohydrates: glucose, maltose, sucrose, and starch. Explain the…

A: Carbohydrates are found in both healthy and unhealthy foods—bread, beans, milk, popcorn, potatoes,…

Q: Cardiology

A:

Q: In the chapter-opening photograph of kernels on an earof corn, what is the genetic basis of the…

A: Part a.The fully pigmented kernel has resulted from the wild-type copy of the C gene expressed in…

Q: What is body mechanics? Discuss at least 3 principles of body mechnics

A: DEFINITION:- Body mechanics is defined as a way to hold the body for peak efficiency during a…

Q: 9) Choose the best answer. Identify the two types of anaerobic respiration.

A: Anaerobic respiration is defined as a biochemical process of respiration not involving oxygen.'…

Q: 1. Insulin..... a. Carries glucose into the muscle cell b. signals the muscle cell to take up…

A: 1. Insulin - b. signals the muscle cell to take up glucose. Explanation - The main actions that…

Q: Explain how the diameter of skeletal muscle fibers varies and what type of muscle tissue grows as…

A: A single muscle cell is made up of muscular fibres. They help in the control of the body's physical…

Q: what animal is fastest ? A canadian goose  B humming bird  C monarch butterfly

A: canadian goose is fastest than humming bird and monarch butterfly . Humming bird is fastest than…

Q: What parasite (genus and species) do you suspect?    What is the life stage for the parasite…

A: Maria is complaining of diarrhea, gastrointestinal pain, and bleeding.

Q: 1 pts List the following events in order as they would occur inside a skeletal muscle fiber: 1)…

A: The signals of contraction of muscles are carried by the nerves at the neuromuscular junction…

Q: Enzymes are catalytic proteins or RNA molecules that accelerate chemical reactions. Substrates  are…

A: Enzymes are biocatalysis that helps to increase the rate of chemical reactions by lowering the…

Q: Virology:What is the name of the cellular receptor that hemagglutinin binds to ? (Be specific ).How…

A: Introduction:- The influenza virus has a genome that is negative sense RNA. This means that in order…

Q: If GTP hydrolysis occurs on a tubulin molecule at the plus end of a microtubule filament before…

A: Tubulin makes up microtubules, which are the cytoskeleton's most important component.

Q: Which of the following bacteria can survive in in temperatures ranging from 39°F (4°C)---to 99°F…

A: Bacteria are single-celled microorganisms that can be found in every environment on Earth. They are…

Q: Terma: Wolbachia, L1, L2, L3, L4, aduit, proboscis, fat body, hemocoel, midgut, hemocyte, melanize,…

A: Heartworm disease is a serious ailment that results in intense lung ailment, coronary heart failure,…

Q: In a two-hybrid test, a certain gene A gave positive results with two clones, M and N. When M was…

A: Introduction :- By looking for physical interactions between two proteins or a single protein and a…

Q: number 32

A: Introduction:- A basic unit of heredity and a sequence of nucleotides in DNA that encodes the…

Q: Which of the following is not consider one of the main factors in the emergence of antibiotic…

A: Antibiotics are drugs which are used to prevent or treat bacterial infections. They operate by…

Q: Give examples, names the three main inflorenscene types of grasses

A: A group or cluster of flowers formed on a stem made of a primary branch or a sophisticated pattern…

Q: Compare the nucleotide-pair sequences of genomic DNA clones and CDNA clones of specific genes of…

A: The main difference between genomic DNA and cDNA is that cDNA represents the transcriptome of a…

Q: An inflammatory condition that affects the sac of synovial fluid outs the joint cavity would best be…

A: Osteoarthritis would be incorrect because it is age-related degeneration in the synovial joints…

Q: Mention the important characteristics of coelenterate and give examples

A: Coelenterate Classification: Kingdom: Animalia Subkingdom: Eumetazoa Phylum: Coelenterate They…