What two properties must a substance typically have to be capable of simple diffusion across a cell membrane? If a substance does not have these properties, can it still cross a cell membrane? How?

Q: The PAM1 matrix penalizes mismatching amino acids more than higher numbered PAM matrices. Explain…

A: PAM (POINT ACCEPTED MATRIX) indicates the probability of a mutation of an amino acid in a given…

Q: Note: Answer the number 3 question only.   Explain.   1. What is the Difference between DNA…

A: Introduction :- A subfield of electromagnetic spectroscopy called specttrophotometry measures a…

Q: Defend the statement that the more and longer we use fossil fuels as the dominant fuel in the world,…

A: Fossil fuels  are the decomposing plants and animals. These fuels are found in the Earth's crust and…

Q: Active transport moves molecules OA. toward the region of lower concentration of the molecule. OB.…

A: Active transport is defined as a type of cellular transport in which molecules tend to move from an…

Q: Magaia et al. illustrated in Figure 2 the relationship of photosynthetic of temperature rate and…

A: In the presence of light, photorespiration occurs when a plant consumes oxygen and releases carbon…

Q: To observe T. spathacea cells, a sharp blade was used to peel off a thin portion of the lower…

A: Introduction Plant cells maintain the Turgor pressure in order to control the cell shape. Turgor…

Q: 500 ML of NS is ordered to infuse over 300 minutes for a patient . using IV pump how many ML per…

A: IV pump means intravenous pump. Intravenous means inside of vein. A patient is given different types…

Q: How is telomerase related to aging?

A: DNA is packed inside the cell in the form of chromosomes and chromatin. The chromosomes are…

Q: The role of O2 in Oxidative Phosphorylation is at the start. to move electrons in the electron…

A: Introduction :  Complex organic macromolecules are broken down into simpler compounds during the…

Q: I need help with the diagrams for aHypertonic, Isotonic, Hypotonic, Solute

A: Tonicity is a property that can make the volume of the cells altered with the water content. The…

Q: Identify and describe (explain) the four forces of evolution. Imagine a scenario where a population…

A: Evolution The process of gaining new traits which are more fitted to survive in changing…

Q: The method of applying the molecular clock to determine the timing of the most recent common…

A: Introduction Our immune system plays key role in defence against harmful foreign particles be it…

Q: Which of the following enzymes is activated in the stomach to promote digestion of dietary proteins…

A: Lipase helps in the digestion of fats. Amylase digests carbohydrates. Trypsin helps in the digestion…

Q: Porphyria is a genetic disorder caused by the inability to properly metabolize a component of…

A: A gene is a piece of genetic material that resides in a specific location on a chromosome. By…

Q: 1) The plot to the right shows the Oxygen Saturation of Hemoglobin (Hb) versus O2 concentration.…

A: Oxygen saturation is a measure of how much hemoglobin is currently bound to oxygen compared to how…

Q: describe the yeast specimens grown on PDA using Dalmau Plate Method incubated at 35°C for 48 hours…

A: Rhodotorula rubra is a yeast cause disease in human like oesophagitis and also cause infection in…

Q: Which of the following is responsible for water exhibiting properties such as adhesion, co- hesion,…

A: Introduction :- Water molecules' interactions with one another are characterised by two qualities…

Q: Which of the following identifies the dependent variable in this experiment? A the concentration of…

A: INTRODUCTION : During any exercise or physical workout, lactate will be a byproduct formed when…

Q: Which neuron component correctly corresponds to an element of an electrical circuit? Extracellular…

A: Introduction :- A protective layer or sheath called myelin develops around nerves, including those…

Q: INSTRUCTION: Answer the question properly Do not copy in Google, plagiarize checker will be used.…

A: Gram-positive bacteria are bacteria classified by the color they change in the staining method. Hans…

Q: A mutant is found that has the following protein sequence in that part of the protein: Tyr Lys Gly…

A: Amino acids are represented by codon. Each codon is made up of three nucleotide bases. A codon can…

Q: Which of the following is not true about sucrose? A Water is a product of the reaction between two…

A: Sucrose is a disaccharide compound, composed of glucose and fructose residue. It is naturally…

Q: Explain why freshwater fish should not drink water and why saltwater fish should to maintain osmotic…

A: Introduction :- Fish that spend most or all of their lives in fresh water, such as rivers and lakes,…

Q: Which CK isoenzyme is elevated in muscle disease? CK-BB, CK-MB, CK-MM, CK-NN?

A: Creatine kinase (CK) is the most often utilised enzyme to identify and track muscle illness. It is…

Q: LARP1 has a highly-conserved region near the C terminus termed the DM15. Co-crystallization…

A: TOP motif stands for Terminal oligopyrimidine motifs. These are the sequences at the 5′ ends of…

Q: 1. A healthy person receives a series of intravenous infusions of anionic dextran with different…

A: A sticky, soluble homopolysaccharide of glucose produced by bacteria and yeasts, particularly…

Q: Review the overall equation of photosynthesis. Inen, use the terms and phrases to complete the…

A: Introduction :- Proteins called enzymes aid in accelerating our bodies' chemical reactions, or…

Q: In order to see the effect the change in humidity had on the transpiration rate, what would be a…

A: Humidity and Transpiration in plants :         Humidity and transpiration in plants are inversely…

Q: Select the organism that matches each description. Some answers may be used more than once, and some…

A: There is given the list of microorganisms that inhabit different places. These are the…

Q: A disease in frogs which causes their tongue to fall out of their mouths is killing the frog…

A: Mutations are sudden changes that occur in the genetic sequence of an individual. There are various…

Q: Apolipoprotein A-1 is the major protein of which lipoprotein? Chylomicrons, VLDL, LDL, or HDL?

A: Introduction :- Apolipoprotein (Apo), a protein found in plasma lipoprotein, has the ability to bind…

Q: The sodium pump is an example of a catabolic process. an anabolic process. stored energy. potential…

A: Introduction : The sodium-potassium pump is a protein pump that has been found in many cells and is…

Q: An example of using enzymes as reagents in the clinical laboratory is:

A: A hexokinase is an enzyme that phosphorylates hexoses (six-carbon sugars), forming hexose phosphate.…

Q: In the lake the biomass of plankton decreased from 65000 to 50000 kg. As a result the biomass of the…

A: In the food chain, one organism eats another. The first trophic level is of producers which include…

Q: what are role incell membrance structure?

A: A cell is the basic structural and functional unit of life. Or living beings are made up of cells…

Q: In the Primula plant, the blue flower color is due to malvidin, a pigment encoded by the completely…

A: In the Primula plant pigment malvidin results in blue color flower which is encoded by dominant gene…

Q: th of the following best describes how the secondary structure of a protein is formed? A B C D 0-0…

A: Secondary structure of a protein refers to any regular, local structure of the protein backbone.…

Q: You are a scientist tasked with writing a journal article on the evolution of alligators. BI U…

A: Alligator is a large reptile of family alligatoridae. Alligators belongs to the Crocodilia order and…

Q: compare the attached diagrams and include a detailed analysis of the diagrams

A: Introduction  There is a conversion of matter in different forms in the form of biogeochemical…

Q: Researchers have found that plants growing in soil with a low sulfur concentration suffer from…

A: Plants need some macro-nutrients in the soil to grow well and reproduce. The first three among them…

Q: D In the following DNA strand, find the position of the start codon, stop codon and determine the…

A: The given DNA strand - GGTACTTTATACCCTGATACATTTGTGGGG Corresponding mRNA strand -…

Q: Please help explain Identification of DAXX as a restriction factor of SARS-CoV-2 through a…

A: DAXX (Death domain-associated protein 6) This gene encodes a multifunctional protein that can be…

Q: The ECG records the electrical stimulation of cardiac muscle by system and not the conduction the…

A: Heart  The special muscular organ of the body which is made by special type of muscles cells known…

Q: True of False: Fatty acids are converted to blood sugar during starvation.

A: Introduction :- The building blocks of fatty acids are what give our bodies and the food we eat…

Q: Ammonia is assimilated by the creation of: explain why you choice the answer  a.glutamine b.…

A: Introduction :- All bodily tissues produce ammonia as various substances are metabolised throughout…

Q: Tabulate the main differences between Gram-positive and Gram-negative bacteria.

A: introduction: A significant class of tiny, unicellular, microscopic creatures known as bacteria are…

Q: A female Australian shepherd with droopy ears (dd) and grey spotting (ss) is mated to a male dog…

A: Genotype is the genetic constituent of an organism. It is a specific genetic makeup of an organism…

Q: Differentiate root hair from a branch root? Please write a correct and expert explanation. Thank…

A: The hardest working part of plant are roots. Due to roots plants are anchored to soil absorbing…

Q: 8. A 60 kg individual needs to work at a MET level of 8 to reach her target heart rate. If the…

A: The grading and the intensity for the question is solved below in the pic :-

Q: Smallest monophyletic group of humans and frogs

A: Monophylatic group The group which includes common ancestor and all of it's descendants.

Osmosis

In simple words, osmosis is the slow, gradual movement of a liquid through a membrane. But there are nuances to this process. For instance, there has to be an imbalance in the distribution of solute in the liquid on either side of the membrane, which has to be semipermeable. The liquid in the region with a lower solute concentration moves to the region with a higher concentration, thereby displacing the solution in the process. The objective is to equalize the concentration of molecules on both sides of the membrane; the displacement of liquid can be viewed as a byproduct of this equalization. Since there is no energy required to carry osmosis, it is considered a passive process.