When the cDNA was sequenced by the Sanger method utilizing ddCTP, the following products were obtained: Tetranucleotide Hexanucleotide Nonanucleotide Decanucleotide Dodenucleotide Octadecanucleotide Nonadecanucleotide

When the cDNA was sequenced by the Sanger method utilizing ddCTP, the following products were obtained: Tetranucleotide Hexanucleotide Nonanucleotide Decanucleotide Dodenucleotide Octadecanucleotide Nonadecanucleotide

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Related questions

Q: The summer is not optimal for grape growing and you're searching in your memory for something…

A: Plant hormones are specific chemical molecules that plants make to regulate their growth and…

Q: 3.Histamine is a signaling molecule that plays a significant role in regulating immune responses…

A: Histamine is a nitrogenous organic molecule that has a role in local immunological responses, as…

Q: Q4/ What is Osteoporosis disease? Explain the pharmacist role in giving the suitable prescriptions…

A: Across most vertebrate animals, a bone is a hard organ that is part of the skeleton. Bones protect…

Q: 7. A 1000 bp EcoRI restriction fragment contains a gene you are interested in. The fragment was…

A: EcoRI is a restriction endonuclease enzyme found in the E. coli bacteria. It's a restriction enzyme…

Q: Briefly describe the relationship between photosynthesis and respiration in terms of the reactants…

A: Introduction Photosynthesis is the process by which green plants use sunlight, carbon-dioxide…

Q: Why RNase H cannot remove all the RNA residue from Okazaki fragments to form a lagging strand?…

A: Ribonuclease H RNase H is a non-sequence-specific endonuclease enzyme. This enzyme catalyzes the…

Q: the humoral response, some B cells differentiate into plasma cells. What do plasma cells produce in…

A: The humoral immune system interacts with antigens obtained from pathogens. These are freely…

Q: 22) A commonly shared action of all antiarrhythmics is that they _____________________. A)…

A: Sinus arrhythmias are abnormal heart rhythms or beats that start at the sinus node. They commonly…

Q: In humans, the genes for red-green color blindness (R = normal, r = color blind) and hemophilia A (H…

A: Given: In humans, The genes for red-green color blindness (R = normal, r = color blind) and…

Q: According to the progressive, or escape, hypothesis, viruses (a) appeared before the three domains…

A: Virus is a relation between living and non living world and it is infectious. This is because ,…

Q: 11.Which of the following blood vessels does not carry oxygenated blood?

A: Oxygenated and deoxygenated blood Oxygenated blood is the blood that contains oxygen or also called…

Q: You made your material in the lab and wish to test for biocompatibility in vitro with a direct…

A: Biocompatibility is the process in which the compatability of the skin can be mediated by using…

Q: major cause of septic shock is the presence of lipopolysaccharide (LPS) from bacteria in the blood.…

A: Septic shock has high modidity and mortality rate due to its effect on circulation in the body which…

Q: All the following are considered acute phase response proteins except: O CRP O Mannose binding…

A: Introduction :- The acute phase response is triggered by an overwhelming immune-inflammatory…

Q: Describe the effects of streptococcal haemoysins giving an example of streptococci that can manifest…

A: A "microbe" is a living entity that is so tiny that it cannot be seen with the naked eye.…

Q: At present, what is the most common cause of death in developed countries? infectious diseases…

A: Introduction :- Infectious diseases are illnesses brought on by bacteria, viruses, fungi, or…

Q: PROTISTS Supergroup Excavata Subgroup Fornicata Distinguishing properties Form cysts Important…

A: Protists are small eukaryotic organisms that come in a variety of shapes and sizes. Protists can be…

Q: Use this phylogenetic tree for a fictional group of insect species to answer the question. A.…

A: Types of Phylogenetic Trees: Rooted Unrooted Bifurcating Multifurcating.

Q: True or false. The supercontinent pangaea formed about four billion years ago.

A: A supercontinent is a landmass that contains most or all of the land on Earth. The landmass formed…

Q: Describe the functions of the following proteins during DNA replication: (i) Polymerase delta (ii)…

A: Introduction DNA replication:- It is the process by which the genome's DNA is copied in cells, It…

Q: Natural Selection A Process of Evolution It wasn't until the year 1800 a man named Jean-Baptiste de…

A: Answer

Q: Two copies of the HbS allele cause sickle-cell anemia, but a single HbS allele helps protect…

A: Sickle cell anemia is one of the sickle cell disease categories of hereditary illnesses. It has an…

Q: Which protein in erythrocytes is responsible for capturing oxygen in the air and delivering it to…

A: Red blood cells, also known as red cells, red blood corpuscles, erythroid cells, or erythrocytes,…

Q: Does concentration of xylulose-5-phosphate increase in cells after eating rice? Explain

A: D-Xylulose 5-phosphate (D-xylulose-5-P) is an intermediate in the pentose phosphate pathway. It is a…

Q: 1. Length of fur is also genetically determined. The allele L produces long fur and its…

A: * Given that Length of fur is Genetically determined. *The allele L produce long fur and another…

Q: An inherited characteristic that increases an organism's ability to survive and reproduce in its…

A: Adaptation: Biological fitness influences the rate of evolution as measured by changes in gene…

Q: A. What are the benefits of shallow rooting and showy inflorescences to desert plants? B. With warm…

A: A.In deserts,there is a very little amount of rain and even the rain water is absorbed by the…

Q: What conclusion can be drawn from embryological development? Insect and bird wings are similar in…

A: Embryo It is the structure that if form after the fertilization of egg and sperm.

Q: In photosystem II proton coupled electron transfer reactions are thought to be necessary after which…

A: *The enzyme photosystem II catalyzes light driven oxidation of water in oxygenic photosynthesis.…

Q: Which of the following is/are true about the two DNA strands that form a helix? (check all that…

A: The DNA or deoxyribonucleic acid is the genetic material in living organisms that is composed of…

Q: In 1985, a 0.5-mm cell was discovered in surgeonfish and named Epulopiscium fishelsoni. It was…

A: Introduction Protozoa are single-celled organisms, either free-living or parasitic, that feed on…

Q: A rare genetic disorder affecting the degradation of hemoglobin made a man suffer extreme…

A: Sangers method is a DNA sequencing method and is also known as enzymatic chain termination method.…

Q: 16) In what situation would a beta blocker be INDICATED? A) Hypertension B) Hypotension C)…

A: Beta blockers are the class of drug that are used in the case of arrhythmia, chest pain, heart…

Q: Describe the effects of streptococcal haemoysins giving an example of streptococci that can manifest…

A: The lysis of erythrocytes is known as hemolysis and the enzyme catalyzing this reaction is called…

Q: Two different species of bacteria are growing together in a mixed biofilm in the intestine of a…

A: Autoinducer-2 (AI-2) is a signal molecule produced by LuxS, an enzyme found in many bacterial…

Q: Given that mammalian cells have much larger chromosomes compared to E. coli cells, how is…

A: The cell division process causes significant alterations in both plant and animal cells. For…

Q: What is audiology and hearing care services In biology ?

A: Biology is a science that studies cells alive and their vital functions. Botany, conservation,…

Q: orange G (yellow) bromophenol blue (purple) xylene cyanol (blue)

A: Gel electrophoresis is a laboratory method used to separate mixtures of DNA, RNA, or proteins…

Q: QUESTION 29 Candida albicans is a [A] that is (83, it can grow in a yeast [C] [D] form, it is the…

A: Candida albicans is non phototropic (i) that is Fungi (A), it can grow in a yeast, hypae (C)and…

Q: Grizzly bears are predators of salmon. If the population of grizzlies in an area decreases, the…

A: Ecosystem balance, often known as "ecosystem homeostasis," is influenced by both factors that tend…

Q: What is a hominin? an order of primates a family of greater apes a family of human-like apes a clade…

A: Hominin refers to any member of the tribe Hominine, which includes all modern and extinct people and…

Q: Instructions: Answer the following problem using the punett square and identify its Genotypic ratio…

A: Allele is the alternative pairs of genes that occupy a specific location on homologous chromosome…

Q: What is the label used in ELISA? Can we use different label? Why, or why not.

A: Answer

Q: How might brain shape reveal clues about hominin history? The globe-shaped brain of modern humans…

A: Modern human beings are the result of the evolutionary process. Over the years, scientific research…

Q: 31. The velocity of a particular enzyme-catalyzed reaction varied with pH as shown in the adjacent…

A: Enzyme activity is at its maximum value at the optimum pH. As the pH value is increased above or…

Q: Differentiate Bone and Cartilage on the basis of the matrix present in these connective tissues.

A: Introduction - Cartilage does not have any blood vessels, whereas bone does. Bones are innervated,…

Q: Please answer fast and all other wise I will give downvote. 1. Memory T cells in circulation tend…

A: All these questions are related to components of the immune system which are studied in a branch of…

Q: Generate a concept map that includes all the specifics below: Classification based on: 1. their…

A: A concept map, also known as a conceptual diagram, is a graphic that shows possible connections…

Q: What molecules are released by activated helper T cells? Note: This is a multiple question, choose…

A: As they are necessary for practically all adaptive immune responses, helper T cells are perhaps the…

Q: Viruses have countered the specific immune defense systems by developing “disabling” or “evasion”…

A: Answer :- As we know that It is deep rooted that the viruses have developed wide assortment of…

Question

100%

When the cDNA was sequenced by the Sanger method utilizing ddCTP, the following products were
obtained:
Tetranucleotide
Hexanucleotide
Nonanucleotide
Decanucleotide
Dodenucleotide
Octadecanucleotide
Nonadecanucleotide
21-nucleotide
6c. What is the sequence of the bases in the mRNA coding for the peptide above?
The

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Below is a sequence of 540 bases from a genome. What information would you use to find the beginnings and ends of open reading frames? How many open reading frames can you find in this sequence? Which open reading frame is likely to represent a protein- coding sequence, and why? Which are probably not functioning protein-coding sequences, and why? Note: for simplicitys sake, analyze only this one strand of the DNA double helix, reading from left to right, so you will only be analyzing three of the six reading frames shown in Figure 19.4.
in the human gene for the beta chain of hemoglobin, the first 30 nucleotides in the amino acid coding region is represented by the sequence 3'TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? If the DNA duplex for the beta chain of hemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.
Shown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein that is 270 amino acids long. The first three bolded base pairs indicate the frame and include the coding region. 5^ ...GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG 3^ 3^.. CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC 5^ Which strand is the template strand for transcription of this gene? Briefly explain how you know. An insertion of one base pair causes the protein to decrease in length by seven amino acids. With respect to the sequence given above, where does this insertion occur? A change of one base pair leads to the protein increasing in the length by one amino acid. With respect to the sequence given above, which base pair would you change, and what would you change this base pair for the protein to increase in the length by one amino acid?
In reversible terminator sequencing, how would the sequencing process be affected if the 3′-end-blocking group of each nucleotide were replaced with the 3′-H present in the dideoxynucleotides used in Sanger sequencing?
If the mRNA produced had the sequence ACGCGU,what would be the tRNA anticodo sequence?
Given the following coding sequence for DNA, provide the sequence of the complementary(template) sequence. 5’ ATGCATAGATTAGGATATCCCAGATAG 3’
If the mRNA produced had the sequence ACGCGU, What would be the tRNA anticodon sequence?
Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′
please list all possible products in a sequencing reaction using ddGTPA as a terminator based on the following sequences of a template : 3'-GGGCTATACCTGACCCTC-5'
For the following sequence, what is the Tm? 5'-AGCTACGATCAGGTCA-3'
Design a pair of primers (22 nucleotides long each) for the following sequence to clone the full sequence atggaatataactctagtccacattccggtgcattttttccaatcgggtcagactcaggatccaaatctccttgtggcagcgtgaacgtcgtctcctctgatggagatggttcaggtgggaatgggagtga
If the DNA duplex for the beta chain of haemoglobin 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5' were transcribed from left to right, deduce the base sequence of the RNA in this coding region.