Where is the start codon located?
Q: Chicken egg contains a lot of proteins which supports the growth and development of the chicken embr...
A: Proteins are composed of twenty standard amino acids attached together via peptide bonds. The linear...
Q: Which of the following sets contain a term which does not belong to the group? O lle, Leu, Val Glu, ...
A: The grouping presented in different options of the given question are grouping of different amino ac...
Q: The segment of DNA shown in the figure has restriction sites I and II, which create DNA restriction ...
A: Agarose gel electrophoresis is generally used to separate the DNA molecules. The cathode or negative...
Q: Addition of strong acid or base to a protein disrupts its disulfide bridges and electrostatic intera...
A: Protein are polymers of amino acids ,and the sequence of amino acids of protein determines protein s...
Q: Give a clear handwritten answer of this in which who have long chain of atoms in which molecules con...
A: Introduction: Macromolecules are larger molecules made from smaller ones. These macromolecules are c...
Q: Five amino acids were subjected to reverse phase chromatography, and the following Rf values were co...
A: Rf value is defined as distance travel by compound divided by distance traveled by solvent. Given Rf...
Q: Peptide Concentration (M) 2.5 x 104 5.0 x 104 10.0 x 104 15.0 x 104 Velocity (M/min) 2.2 x 106 5.8 x...
A: Km is the substrate concentration at half vmax.vmax is the maximum rate of reaction catalysed by Enz...
Q: Write the net ATP in glyconeogenesis and write the net reaction of it...
A: Glyconeogenesis is the synthesis of sugars like glucose and glycogen from sources other than carbohy...
Q: Which statement below best describes the main difference between how scientists define data and hypo...
A: Scientific Hypothesis is a part of scientific method which consists of 6 different steps. Scientific...
Q: Give the similarities and differences of the gel filtration and isoelectric precipitation in terms o...
A: Protein Purification: Modern protein science lab and related industries overexpress target protein i...
Q: 2. During the meal, two different persons both got some dietary lipids, but the content of fatty aci...
A: The coding of amino acid is in the form given below total number of Carbons : number of double bond ...
Q: Why Sexual is the most important type of variation in human?
A: Sexual variation causes genetic diversity in humans . Genetic diversity is important because it give...
Q: 8. In patients after prolonged hepatitis, the ALT and AST activities were measured in the blood seru...
A: Hi. Thank you for the question. As per the honor code, we are allowed to answer three sub-parts at a...
Q: Look at the amino acid composition of a protein given in the table and click on the area in the 2D g...
A: the isoelectric point of an amino acid is the pH at which the net electric charge of that amino acid...
Q: Which of the following is true of primers that are used in DNA replication? They are made out of ...
A: DNA replication is the process of copying the DNA ,in which the both the strands of the DNA molecule...
Q: Which of the following DNA pol I activities would be MOST important in the removal of the primer? ...
A: DNA polymerase is the key enzyme for DNA synthesis. DNA polymerase requires a single stranded DNA a...
Q: Ribosomal RNAs (rRNAs) are another example of a functional RNA molecule. Based on Figure 9-11, what ...
A: Molecules of rRNA are synthesised in the nucleolus, a specialised part of the cell nucleus that appe...
Q: Suppose you have a solution of 0.1 M H2CO3 and 0.1 M NaHCO3. Which of the following reactions takes ...
A: A buffer solution is composed of a weak acid and its conjugate base. Buffer solution resists the cha...
Q: phosphogiuCOse isomerase refers to phosphoglucomutase (M), phosphoglucose isomerase (0, both enzymes...
A: Answer - Glucose metabolism by which glucose breakdown and provide energy for body normal function....
Q: The gene for the primase enzyme is mutated and is nonfunctional. What is the result of such a mutati...
A: DNA replication unlike transcription cannot start ab initio and requires a primer that is elongated ...
Q: what type of inhibition is shown and where does the inhibitor bind to the enzyme?
A: Enzymes are usually protein molecules which catalyzes the biochemical reaction by decreasing the act...
Q: All coenzymes are cofactors. However, not all cofactors are coenzymes. O Both statements are incorre...
A: Enzymes require cofactors for their activity. It means in the absence of its specific cofactor an en...
Q: The zinc ion in zinc fingers is coordinated through histidine and cysteine residues.
A: ZnFs( Zin fingers ) are small domains of protein with a vital structural role for zinc. They are div...
Q: . To which class does each enzyme belong? Explain your answers. a.) pyruvate decarboxylase b...
A: As you have posted multiple questions we are supposed to solve only the first question ..If u want a...
Q: Which of the following disaccharides produces two different monosaccharides upon hydrolysis? maltos...
A: Disaccharides are the Carbohydrate molecules made up of two monosacharide units. The monosacharides ...
Q: 1. 2. 3. A* 4. H-
A: The solvation of a solute by water is called hydration.
Q: (a) Vanillic acid is a phenolic compound found in vanilla and many other plant extracts. It is a fla...
A: According to shikimate pathway, Phenylalanine goes through biosynthesis wherein p-coumaroyl coenzym ...
Q: Short Answer Questions Draw and name three different functional groups. Draw the basic structure of ...
A: Biomolecules refer to carbon- based organic compound that are produced by a living organism. These c...
Q: Describe the first step of B-Oxidation in peroxisomes ( name substrates , products, and eznymes) Wha...
A: Beta Oxidation: this is the process during which Fatty acids are broken down in mitochondria to rele...
Q: The electron transport chain (ETC), or respiratory chain, is linked to proton movement and ATP synt ...
A: Introduction: The electron transport chain is the movement of electrons from NADH and FADH2 to oxyge...
Q: • In a globular protein, where would you expect the nonpolar regions to be located? Whereabouts woul...
A: Proteins are classified into two main groups based on their Molecular shape. They are 1) Globular pr...
Q: Assume that mitochondria contain 0.35 Molar KCL and 0.012 Molar NaCl. Calculate the grams per liter,...
A: Osmolarity is defined as the concentration of a solution expressed as the total number of solute par...
Q: Five amino acids were subjected to normal phase chromatography, and the following Rf values were com...
A: Retention factors are useful for the comparison of the results of chromatographic separation of one ...
Q: Ennumerate the essential amino acids and identify the functional groups present in their structures....
A: Aminoacids are the building blocks of proteins that are linked by peptide bond. Aminoacids are class...
Q: Importance of Ferrous Oxalate
A: Ferrous oxalate is also known as iron oxalate. It is also stated as the ferrous salt of oxalic acid....
Q: COO COO HC- CO0 C-H CH HO-CH COO CO0 COO O ligase O transferase O lyase O isomerase O hydrolase oxid...
A: The enzymes can be classified based on the type of reactions that they catalyze (example, ligase, ly...
Q: Enzymes that catalyze DNA denaturation or melting are: gyrases topoisomerases helicases ...
A: DNA is a genetic material that is a double stranded structure polymer of nucleotides. DNA replicatio...
Q: Which two amino acids may be encoded in genes by stop codons? OA. L-Hydroxyproline and L-Hydroxylysi...
A: The genetic code is universal and every individual amino acid is coded by a triplet codon. The Tripl...
Q: Assume that the reaction Arabinose +Pi Arabinose-6-P has a delta G of +13.0 kJ/mol and the reaction...
A: Arabinose +Pi gives Arabinose-6-P (i) Delta G1 =+13.0 kJ/mol XTP gives XDP + Pi ...
Q: 16. What would be the expected result in electrolytes if there has been a carry over of anticoagulan...
A: K+ will be elevated up to 7.0mEq/L A healthy plasma/serum K+ level is in the range of 3.5-5.2 mmol/L...
Q: Why does L-amino acids prevail in biological systems?
A: Amino acids are organic molecules composed of carbon, nitrogen, hydrogen, and oxygen. Amino acids m...
Q: While performing the Biuret test, a student added HCl instead of NaOH. How will a resulting solution...
A: Biuret test is the specific test for the identification of proteins in a sample solution. Biuret rea...
Q: What is measured at the A260 absorbance values?
A: DNA and RNA absorbs UV light due to heterocyclic rings of the nucleotides that is present in the nuc...
Q: In general, proteins can be classified into 3 different groups. Name and give a short description of...
A: Proteins are considered as large biomolecules and also a macromolecules which comprise one or more l...
Q: Phosphoglycerate mutase transfers a phosphoryl group from C3 of 3-phosphoglycerate to C2 position t...
A: Phosphoglycerate mutase transfers the phosphate group on C3 of 3-phosphoglycerate to C2, this covert...
Q: Which is responsible for the stabilization of parallel polypeptide chains in a beta-pleated sheet co...
A: Secondary structure refers to the local folded structures that occur inside a polypeptide as a resul...
Q: „CO2 *H3N CO2 „CO, aminotransferase PLP `Ph Ph a Ammonia b L-Valine L-Lysine d L-Alanine
A: Transamination is the process of the transfer of an amino group from one amino acid to a keto acid. ...
Q: Consider the following peptide sequence: His-Pro-Lys-Arg-Ala-Gln-Ser-Cys-Pro Which test will the p...
A: Millon's test is an analytical test that is used for the identification of the amino acid tyrosine i...
Q: For the purpose of energy utilization, what are the advantages of generating energy from lipids as c...
A: Sugars, starch, and cellulose are among a vast group of organic molecules found in meals and biologi...
Q: draw an isomer of the triglyceride in sunflower seed oil. Show the reaction and write out the produc...
A: Hydrogenation is the process of chemical modification that is performed by addition of hydrogen to (...
Step by step
Solved in 3 steps
- A single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a) Using the same strand above as a template, write the pre-mRNA transcript. b) List the molecules that must be present for DNA to be transcribed. Briefly describe their function. c) What are three modifications that happen to pre-mRNA before it becomes mature mRNAWhy is the post-transcriptional polyA tail an important addition to a mRNA molecule? a.poly A tail is part of the protein translated from the mRNA b.poly A tail facilitates the binding of ribosomes c.3' tail signals the end of transcription by the RNA polymerase d.the tail adds stability to the transcript, controlling the time of degradation e.poly A tail facilitates the splicing of intronsConsidering the given sequence of nucleotides in an mRNA molecule, (a) what is the sequence of the DNA template strand from which the RNA was synthesized? (b) What peptide is synthesized by this mRNA sequence? 5' GAG CCC GUA UAC GCC ACG 3'
- Which two sequences shown in the diagram are NOT directly transcribed from the template strand of DNA for this mRNA? ( select all that apply) a) The exons b) 5' cap c) 3' poly-A tail d) UGA e) AUGWhere does mRNA/tRNA codon-anticodon recognition take place? a)40S b)50S c)The surface between the two ribosomal subunits d)30SThe base sequence of the gene coding for a short polypeptide is 5’CTACGCTAGGCGATTGATCATC’3. a) What would be the base sequence of the mRNA transcribed from this gene? Highlight the start codon sequence b) State the amino acid sequence of the polypeptide translated from this mRNA c) Based on the information from part (a) and (b), describe the process used by eukaryotes to produce protein.
- What happens immediately after the initiation complex forms during translation? (a) peptide bond formation (b) the DNA associated with the promoter unwinds (c) the small and large subunits of the ribosome come together (d) primers are formed (e) phosphodiester bond formationThe codon UUU in an mRNA molecule which results in phenylalanine being inserted as the protein is made. Which will be a characteristic of this codon? a. The tRNA molecule that binds to the UUU codon must have an AAA anticodon. Nde ba e2? b. UUU could code for both phenylalanine and alanine during translation. c. The aminoacyl-tRNA synthetase for phenylalanine binds only the UUU codon. d. UUU is probably only one of several codons that code for phenylalanine._______is/are removed from a new mRNA. a. Introns c. A poly-A tail b. Exons d. Amino acids
- Transcription & Translation A. Describe mRNA splicing. B.How do mRNA and rRNA interact? C.How do mRNA and tRNA interact?Which is the correct option here? How can one primary transcript result in several polypeptides with different amino acid sequences. A. Phosphorylation of proteins after translation B. alternative splicing of exons C. An addition of polyA tail to mRNA D. Incorporation of an amino acid at a stop codonGiven is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’ a. What is the complementary strand? b.Deduce the mRNA in this coding region. c.What is the amino acid sequence based on this mRNA? d. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?
