The base sequence of the gene coding for a short polypeptide is 5’CTACGCTAGGCGATTGATCATC’3. a) What would be the base sequence of the mRNA transcribed from this gene? Highlight the start codon sequence b) State the amino acid sequence of the polypeptide translated from this mRNA c) Based on the information from part (a) and (b), describe the process used by eukaryotes to produce protein.

The base sequence of the gene coding for a short polypeptide is 5’CTACGCTAGGCGATTGATCATC’3. a) What would be the base sequence of the mRNA transcribed from this gene? Highlight the start codon sequence b) State the amino acid sequence of the polypeptide translated from this mRNA c) Based on the information from part (a) and (b), describe the process used by eukaryotes to produce protein.

Name: The base sequence of the gene coding for a short polypeptide is 5’CTAC
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: The base sequence of the gene coding for a short polypeptide is 5’CTACGCTAGGCGATTGATCATC’3.a) What would be the base sequence of the mRNA transcribed from this gene? Highlight the start codon sequenceb) State the amino acid sequence of the polypeptid

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 10QP: If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense...

See similar textbooks

Similar questions

A. What amino acid sequence is encoded by the codon sequence AUAAUGGUAACGGUU? B. Suppose the codon sequence AGACACUCUAUUAAA has a single base pair mutation to AGACACUCUUUUAAA. If the old protein sequence was Arg-His-Ser-Ile-Lys, what will be the new sequence encoded by the mutant gene?
Given the template DNA sequence: 3’ - TAC - CAG - GTT - ACC - ATC - 5’ A.) What will be the mRNA requence corresponding to the template DNA sequence? B.) What is the amino acid sequence in letter A? ( e.g. Arg, Phe, etc.) C.) If the coding sequence of the dsDNA will "serve" as the template for transcription, what is the corresponding mRNA sequence? D.) With the mRNA transcript in letter C, what will be the amino acid sequence? ( e.g. Arg, Phe, etc.)
The following is as segment of mRNA: 5'-UCGGAAUGUGGUGGCAUACAGGCUUACAGAACUAAGUCUGAGAAU-3' A. How many amino acids long will be the protein translated from the only reading frame available in this segment? B. If a mutation changes the third letter of the stop codon in the only reading frame available in this segment, how many amino acids long will be the protein translated?
Refer to the DNA sequence provided: 3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ a. What is the mRNA transcript of the anticoding strand of the DNA model? b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNA in (a)?
Consider the following mRNA base sequence 5' CUG-CAC 3' (a) What dipeptide is coded for by this mRNA? (b) What dipeptide is formed if a mutation converts CUG to CUU? (c) What dipeptide is formed if a mutation converts CAC to CGC? (d) What dipeptide is formed if a mutation converts CUG to CUU and CAC to CGC?
What is the total size of the mature i.e. fully processed mRNA in nucleotides? How many amino acids would the encoded protein be? Assume that the N- terminal Met encoded by the AUG start codon, is NOT cleaved from the protein?
The mRNA formed from the repeating tetranucleotide UUACincorporates only three amino acids, but the use of UAUC incorporates four amino acids. Why?
give the amino acids specified by the following bacterial mRNA sequences. a. 5′ –AUGUUUAAAUUUAAAUUUUGA–3′ b. 5′ –AGGGAAAUCAGAUGUAUAUAUAUAUAUGA–3′ c. 5′ –UUUGGAUUGAGUGAAACGAUGGAUGAAAG AUUUCUCGCUUGA–3′ d. 5′ –GUACUAAGGAGGUUGUAUGGGUUAGGGG ACAUCAUUUUGA–3′
1. If the gene above is transcribed into a functional mRNA, a.) how many codons will be carried by the functional mRNA? b.) what is the sequence of the 25th codon? c.) what is the sequence of the stop codon? 2. If the mRNA transcribed for this gene will be translated into a functional protein, a.) how many amino acids will be used to build the polypeptide chain? b.) what is the amino acid coded by the 25th codon? c.) what is the amino acid coded by the last codon? 3. If the above gene is one of the three structural genes of the lac operon that codes for the protein/ enzyme responsible for breaking lactose into two molecules of simple sugars, a.) what triggers the activation of this gene? b.) what triggers the inactivation of this gene? c.) what substance is attached to the operator region of the operon in the absence of activator? d.) what gene is responsible for the synthesis of the substance used to attach in the operator region in the absence of activator? e.) what…
1. If the gene above is transcribed into a functional mRNA,a.) how many codons will be carried by the functional mRNA?b.) what is the sequence of the 25th codon?c.) what is the sequence of the stop codon?2. If the mRNA transcribed for this gene will be translated into a functional protein,a.) how many amino acids will be used to build the polypeptide chain?b.) what is the amino acid coded by the 25th codon?c.) what is the amino acid coded by the last codon?
Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic messenger RNA with DNA from a genomic clone containing the full-length gene corresponding to the mRNA. (a) How many exons does the gene contain? How many introns? (b) Where in this structure would you expect to find a 5′,5′-internucleotide bond? Where would you expect to find a polyadenylic acid sequence?
The following represent deoxyribonucleotidesequences in the template strand of DNA:Sequence 1: 5'@CTTTTTTGCCAT@3'Sequence 2: 5'@ACATCAATAACT@3'Sequence 3: 5'@TACAAGGGTTCT@3'(a) For each strand, determine the mRNA sequencethat would be derived from transcription.(b) determine the amino acidsequence that is encoded by these mRNAs.(c) For Sequence 1, what is the sequence of the codingDNA strand?