Which animal do you think would have the longest intestine/longest digestive time? O A carnivore like a wolf An omnivore like human that eats both plant and animal material O An herbivore that eats only nutrient poor leaves O A detritivore that eats dead/decaying material like an isopod

Which animal do you think would have the longest intestine/longest digestive time? O A carnivore like a wolf An omnivore like human that eats both plant and animal material O An herbivore that eats only nutrient poor leaves O A detritivore that eats dead/decaying material like an isopod

Aquaculture Science

3rd Edition

ISBN:9781133558347

Author:Parker

Publisher:Parker

Chapter7: Management Practices For Crustaceans And Mollusks

Section: Chapter Questions

Problem 1KA

See similar textbooks

Related questions

Q: A patient who suffered a stroke was asked to read a simple phrase and to repeat it back to the…

A: Q. A patient who suffered a stroke was asked to read a simple phrase and to repeat it back to the…

Q: Question 5 To identify genes associated with the movement disorder Parkinson's disease, you decide…

A: Inorder to amplify a double stranded DNA via PCR, we require 2 sets of primer; a forward primer and…

Q: Explain two major SARS-CoV-2 entry mechanisms

A: A virus surface spike protein mediates SARS-CoV-2 entry into cells. To fulfill its function,…

Q: Please give me a discussion/explanation of (LEAD DISCOVERY) part in drug discovery and development.

A: Lead Discovery Leads are the compounds for which the chemical structure has been identified and…

Q: Please answer asap You are caring for a patient with pulmonary (lung) Mycobacterium tuberculosis The…

A: Pathological presentation of infection caused by bacteria Mycobacterium tuberculosis .

Q: What are the different types of PCR and their product concepts? Site and explain the comparison…

A: Introduction :- Polymerase Chain Reaction (PCR) is a molecular biology technique for making multiple…

Q: thus, clonal expansion is The HIV attack the O Helper T cell / inhibited O Regulatory T cells /…

A: Answer :- Option (A) is correct. - Helper T cell / inhibited.

Q: Test Ill- Encircle the word that should not belong to the group. 41. mushroom, yeast, bacteria, mold…

A: Spider is an arachnid, arachnids have eight legs.

Q: There are many different sources of biomass and many ways of harnessing energy from biomass. Discuss…

A: Introduction The exponential rise in population and in increasing demand for food and fuel lead us…

Q: Use the genetic code table to determine the amino acid sequence of the given message strand of DNA…

A: Proteins are made up of amino acids, which are a type of molecule. The basic components of life are…

Q: a.) The conversion of the genital ridge into the bipotential gonad requires the Sf1, Wt1, and Lhx9…

A: Sex determination : There are certain genes which plays important role in sex determination. But…

Q: To determine: The special properties that an enzyme isolated from a psychrophilic bacterium will…

A: Psychrophillic bacteria are organisms capable of existing at a far lower temperature than usual,…

Q: Pain is ... an illusion a weakness strictly substantia gelatinosa cell activity emotional and…

A: Introduction :- Substantia gelatinosa is a group of cells in the grey portion of the spinal cord…

Q: Which is the smallest? O A. a human red blood cell O B. an E. coli cell O C. the influenza virus O…

A: The size of microbes is often defined as tiny. As a result, they are invisible to the naked sight.…

Q: In onions, male sterility is due to the interaction of a chromosomal allele pair hh and "sterile"…

A: Cytoplasmic inheritance occurs when the DNA from the parents' cytoplasmic organelles is inherited by…

Q: In a lab, researchers induced a mutation to the Gal3 gene in yeast. The original sequence of the…

A: DNA ( Deoxyribonucleic acid ) is two stranded ladder like helical structure which acts as genetic…

Q: Supposing two strains of autotetraploid plants are available and their genotypes are as follows.…

A: Tetraploidy (four sets of chromosomes, 2n = 4x) is common in many plant species, and also occurs in…

Q: why we should be careful not to touch the throat swab to the lips, tongue, or uvula.

A: A throat swab is used to distinguish the presence of group A streptococcus microbes, the most…

Q: The diagram on the right has been drawn to scale. The width of the cell has been drawn at 5 cm. What…

A: Cells have different sizes, shapes, and structures. The sizes are usually measured in units like…

Q: Topic: Human Sex Anomalies Describe the following : a.1. XYY sex anomaly a.2. Jacob’s syndrome…

A: The loss, damage, or inclusion of one or both sex chromosomes causes or affects a set of genetic…

Q: current themes in depression

A: Depression Depression is defined as a state of mind where the mood is not happy. It causes a lack of…

Q: Most land animals with exoskeletons are smaller than the volume of a mouse, and most vertebrates are…

A: Introduction In contrast to a human's internal skeleton (endoskeleton), an exoskeleton is the…

Q: Which heart do you think is most efficient at delivering oxygen rich blood to the tissues? O 3…

Q: S-TAGTAGGOOGCATOTTTTCCCATACAGATGAAGGATAAACTCGTCTXTAT-3 [x]-cleavage site for CFICFII endonuclease…

A: DNA ( Deoxyribonucleic acid ) is two stranded , ladder like helical structure that functions as…

Q: A population of wolves in a national park is known to be 150 individuals. As wildlife ecologist, you…

A: Ecosystem balance, often known as "ecosystem homeostasis," is influenced by both factors that tend…

Q: The circulation and the homeostasis of the cellular environment: Describe (in the correct order)…

A: Introduction Homeostasis, which is described as a self-regulating mechanism through which an…

Q: Arial T 26 BIUA 三三三三三 3 5 6. Exhibit ES-3 Summary of Past CO₂ Emissions (MMTCO₂e) in Colorado SIT…

A: Carbon dioxide emissions or CO2 emissions are emissions stemming from the burning of fossil fuels…

Q: Elaborate on the statement “embryonic development involves both activation and inhibition”. Support…

A: Embryonic development involves both activation and inhibition.

Q: Lack of calcium in muscles: O results in no contraction causes weak contractions causes strong…

A: Effect of calcium concentration in muscle contraction.

Q: f the lophophore is absent in brachiopods, would you consider them to be members of Mollusca? Why or…

A: Definition: - A lophophore creates a continuous, laminar water flow, induced by the lateral cilia on…

Q: SUBJECT-GENETICS TOPIC: Inheritance Related to Sex Identify some form of abnormalities wherein it…

A: Genetic abnormalities - Genetic abnormalities are conditions caused by changes to the genes or…

Q: Discuss and make comparisson about the reproductive organs of birds and reptiles. How are their…

A: Reptilia and aves Reptilia is a taxonomic class that includes all the reptiles, examples of reptiles…

Q: QUESTION 1 You are studying a mutant strain of e.coli. When you add lactose to the media of this…

A: Lac operon is the segment of DNA which is involved in the breaking down of lactose into glucose in…

Q: Spongy bone is found: in the periosteum in the ends of long bones O inside lacunae only in the fetal…

Q: To define: The term allosteric enzyme and allosteric effector.

A: A metabolic pathway is a series of interconnected biochemical reactions that convert a substrate…

Q: Which of the following mutations will most likely cause allelic dropout when amplifying an STR…

A: Each person is marked with two alleles that are present one each STR. This allele is inherited from…

Q: . Which of the following repair mechanisms can lead to frameshift mutations? a. Nonhomologous…

A: 1.Answer-- correct option is (b) Nucleotide excision repair

Q: Which muscle cells would you use more of, if you train to run a marathon? O Slow twitch cells O Fast…

A: There are three types of muscle - A. Skeletal muscle - Voluntary and striated. B. Smooth muscle -…

Q: Is integrated pest management technique is better than using only one type of pest technique?…

A: IPM is the new method to prevent the pests from destroying our food that is growing anywhere in our…

Q: D. Fill in the table below. Determine the correct template and coding strands to properly answer…

Q: Why do you think celiac disease causes several types of symptoms and potentially serious…

A: Introduction Autoimmune diseases:- It is a condition when your immune system attacks healthy cells…

Q: To determine: The special properties that an enzyme isolated from a psychrophilic bacterium will…

A: Enzymes are biocatalysts that aid in the acceleration of the reaction. They are proteins that help…

Q: Label completely the cross-section of frog skin and alligator skull.

A: Frog Frog is mostly aquatic leaping amphibians having thin bodies, smooth wet skin, and strong long…

Q: Gene flow can have one effect in the context of a single population, and a different effect in the…

A: Gene flow is the movement of genes or alleles between populations separated by geography. The…

Q: In onions, male sterility is due to the interaction of a chromosomal allele pair hh and "sterile"…

A: Cytoplasmic inheritance is a phenomenon that occurs when DNA from the parents' cytoplasmic…

Q: 2. Label the muscles on the dorsal and ventral sides of the frog. Write all the answers in the next…

A: Frog contains many muscles on their dorsal and ventral sides. These muscles are needed to perform…

Q: Identify the correct order of the following processes: 1. urine is stored in the bladder; 2. blood…

A: Kidney is a chief organ of excretory system which blood is filtered and formation of urine takes…

Q: Why do dieters who follow Atkin’s diet (a diet high in fat and protein and very low in carbohydrate)…

A: Atkins diet It is diet that involves the uptake of foods that are rich in proteins and fats and the…

Q: Thymus gland is important during early childhood in immune system development. Why is this so?…

A: Introduction Thymus gland:- It is a small organ that lies in the upper chest under the breastbone,…

Q: 13. Directional selection means that a. The environment controls which organisms will survive. b.…

A: Introduction Selection:- It is the preferential survival and reproduction or preferential…

Concept explainers

Modes of Nutrition

It is a biological process of providing or obtaining food that is necessary for growth and health. It includes many physiological processes - absorption, ingestion, assimilation, catabolism, excretion, etc. In biology, the science that deals with nutrition's physiological and chemical processes are called "nutritional science."

Question

Which animal do you think would have the longest intestine/longest digestive time?
O A carnivore like a wolf
An omnivore like human that eats both plant and animal material
O An herbivore that eats only nutrient poor leaves
M
O A detritivore that eats dead/decaying material like an isopod
P

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

What is the mode of nutrition of an organism named Monkey? a.)Photo-autotrophic b.)Chemo-autotrophic c.)Saprophytic d.)Parasitic e.)Herbivore f.)Carnivore g.)Omnivore
three living creature, X,Y,Z. They are given food m and n, where m is obtained from plants and n from meats. X eats m, Y eats n, Z eats both. How you are going to categories the living creatures based on their food source?
Classify the following animals into carnivores, herbivores and omnivores A) Elephant B) Human being C) Cat D) Rat E) Goat
What is the mode of nutrition of an organism named Vulture? a.)Photo-autotrophic b.)Chemo-autotrophic c.)Saprophytic d.)Parasitic e.)Herbivore f.)Carnivore g.)Omnivore
Which of the following animals uses the largest percentage ofits energy budget for homeostatic regulation?(A) marine jelly (an invertebrate)(B) snake in a temperate forest(C) desert insect(D) desert bird
If a primate has a very complex digestive system, what type of diet do they have? A. Frugivore B. Folivore C. Gummivore D. Insectivore
An animal’s feeding adaptations are an integral part of its behavior and usually shape the appearance of the animal itself. Discuss contrasting feeding adaptations of carnivores and herbivores.
Which of the following would you expect to be TRUE of an herbivore: -More canine teeth than molars -An extended cecum -Fewer endosymbionts than found in omnivores -A shorter, simpler digestive tract A- longer esophagus
Some species of animals gain physiological advantages byexploiting the specialized physiological capabilities of otherspecies. Explain how marine mammals that prey on teleost fishrather than invertebrates illustrate this principle. Also explainhow carnivorous mammals that prey on herbivorous mammalsin deserts illustrate the same principle.
What is the definition of the word carnivore? An organism that obtains energy by feeding on other organisms. An animal that eats other animals An animal that eats only plants An animal that eats both plants and animals
Which digestive system is characterized by a long digestive system, and a very large caecum? Group of answer choices Omnivore Herbivore Carnivore
Humans have the most urgent need for a continuoussupply of ________.a. foodb. nitrogenc. oxygend. water