Which heart do you think is most efficient at delivering oxygen rich blood to the tissues? O 3 chambered heart of amphibians O4 chambered heart seen in reptiles that are not birds O 2 chambered hearts of most fish 4 chambered heart seen in mammals and birds

Q: D. Fill in the table below. Determine the correct template and coding strands to properly answer…

A:

Q: Will reveal RFLP polymorphism between the DNA samples after probe detection/visualization; and

A: Restriction Fragment Length Polymorphism (RFLP) is a difference in homologous DNA sequences that can…

Q: ? Which one is true For few seconds the blood supplies CO2 to cells and picks up 02. For few mints…

A: Blood Supply of Heart The heart receives its own supply of blood from the coronary arteries. Two…

Q: Is integrated pest management technique is better than using only one type of pest technique?…

A: IPM is the new method to prevent the pests from destroying our food that is growing anywhere in our…

Q: Supposing two strains of autotetraploid plants are available and their genotypes are as follows.…

A: Tetraploidy (four sets of chromosomes, 2n = 4x) is common in many plant species, and also occurs in…

Q: Test Ill- Encircle the word that should not belong to the group. 41. mushroom, yeast, bacteria, mold…

A: Spider is an arachnid, arachnids have eight legs.

Q: a. Use a labelled b. Explain how th operon?

A:

Q: . In animals, cytokinesis occurs in which of the following phases of mitosis? a. Telophase b.…

A: Introduction: Cytokinesis is the literal division of a cell, which occurs in both mitosis and…

Q: A person has a blood pressure of 145/95. What does the number 145 represent? Select one: O a.…

A: ANSWER) (c) systolic pressure due to ventricles contracting. Systolic blood pressure is the pressure…

Q: Which of the following is least likely to produce genetic variation in the offspring of an…

A: Genetic variation is the changes in the genes of offspring from the parents. Meiotic cell division…

Q: eueu For each genotype below, select whether it is heterozygous, homozygous dominant, or homozygous…

A: First of all let us check what the terms mean, Heterozygous: It means an organism having two…

Q: 9. The water in warmer streams possess d. Feed the beans to the chickens, wait for the chickens to…

A: C. More ,less,more

Q: Select the correct statement about the function of myocardial cells. Cardiac muscle cells are…

A: Introduction The absolute refractory period of muscle cells refers to the time following a muscle…

Q: Gene flow can have one effect in the context of a single population, and a different effect in the…

A: Gene flow is the movement of genes or alleles between populations separated by geography. The…

Q: What is the average age in the United States that menarche typically begins? a. 10 c. 13 b. 12 d. 14

A: Menarche is one of the most significant periods in women's life. It is the beginning of menstrual…

Q: Discuss the importance of oxygen in this process of aerobic respiration.

A: Aerobic Respiration is the process of cellular respiration that occurs in the presence of oxygen gas…

Q: Why do dieters who follow Atkin’s diet (a diet high in fat and protein and very low in carbohydrate)…

A: Atkins diet It is diet that involves the uptake of foods that are rich in proteins and fats and the…

Q: Plants are highly dependent upon the resources of their enviroment. Explain how the lack of water…

A: In photosynthesis, two reaction has been shown light dependent reaction and light independent…

Q: Compare the reproductive organs of reptiles and birds. How are their reproductive patterns…

A: Introduction The biological system of an organism's reproductive system, often known as the genital…

Q: Elucidate the fundamental challenges the aquatic vertebrates and terrestrial vertebrates face in…

A: Terrestrial Vertebrates:  Land-based (land-dwelling) Non-native Vertebrates (animals having a…

Q: S-TAGTAGGOOGCATOTTTTCCCATACAGATGAAGGATAAACTCGTCTXTAT-3 [x]-cleavage site for CFICFII endonuclease…

A: DNA ( Deoxyribonucleic acid ) is two stranded , ladder like helical structure that functions as…

Q: Please answer them correctly - Please answer all of them, they are connected. MUTATION Fill in the…

A: Introduction DNA is an organic molecule that includes genetic information as well as instructions…

Q: How many steps (inhalations/exhalations) are needed to complete one ventilatory cycle in birds? 3…

A: Introduction Inspiration (or inhalation) and expiration (or exhalation) are the two phases of…

Q: Which is the smallest? O A. a human red blood cell O B. an E. coli cell O C. the influenza virus O…

A: The size of microbes is often defined as tiny. As a result, they are invisible to the naked sight.…

Q: Which of the following diseases is caused by a pathogen that is NOT a living organism? O A. Guinea…

A: A pathogen is an infectious agent that causes a disease. In general, there are five main types of…

Q: What are muscle groups that work together for a common action or movement called? O Antagonistic…

A: Anatomical terminology are terms used to determine the action , position , size of muscle.…

Q: Which of the following cells form new bone in bone tissue? osteons O osteoblasts osteocytes O…

A: The cells that forms new bone in bone tissue are osteoblasts.  Explanation :  Osteoblasts are the…

Q: You see that a piece of DNA is being copied. But you cannot tell if this an example of DNA…

A: DNA replication is a process that makes multiple copies of particular DNA fragments so that they can…

Q: 56 Platt and Glimcher found that the firing of neurons in the lateral intraparietal area are…

A: The lateral intraparietal area is located in the intraparietal sulcus of the brain and this region…

Q: Are Invasive Species All Bad?

A: Invasive species are the Exotic species which are introduced to a new habitat they have the ability…

Q: Which statement best describes a characteristic of ALL arteries? Select one: O a. Arteries lead…

A: Introduction Blood vessels are tubes that transport blood throughout the body. They form a…

Q: silence genes

A: Gene silencing is a mechanism that regulates gene expression to define cell fate and also regulates…

Q: This muscular blood vessel regulates blood pressure an blood flow to the capillaries. O Arteriole O…

A: Answer is arteriole

Q: Describe the underlying osmoregulation issues that aquatic and terrestrial animals confront, as well…

A: Osmoregulation is defined as the maintenance of water and salt concentration within the body.…

Q: A student was observing a filament of blue green bacteria under low power (60X). The diameter of the…

A: A. Average length of one cell = 2.4 mm/ 40=0.06 mm Under 60X = 40 cells, each is 0.06 mm in length

Q: Heparan sulfate proteoglycans appertain to which of the following processes?* a. transport by…

A: Heparan sulfate proteoglycans are the extracellular matrix proteins. These are basically the…

Q: different cues either The illustration above depicts a male redwing blackbird responding to two…

A: The male redwing blackbird is saving his territory from another male in order to attract female for…

Q: When the body is exposed to the same virus a second time, the immune response is Accompanied by…

A: Any foreign substances or pathogen can be harmful to an organism. Hence, the organism will develop…

Q: To explain: Why at anaerobic conditions the consumption of glucose by cells is high and at aerobic…

A: Metabolism refers to the collection of hundreds of enzyme-catalyzed reactions that the organism uses…

Q: The structure of the C4 leaf shows how mesophyll cells hug the epidermis of the leaf. hug the bundle…

A: Photorespiration is a wasteful pathway that occurs when the Calvin cycle enzyme rubisco acts on…

Q: You were asked to invent substitutes for blood vessels (artery, capillary, and vein). What materials…

A: To produce the vascular prostheses, polymer solutions were spun in an electrical field to form very…

Q: A measure of the productivity of photosynthesis is the rate of a. water production. b. heat…

A: d) Oxygen production .

Q: What do young herring gulls want when they peck the red spot on their parents' bills?

A: Pecking is a specialised behaviour in words suggesting that they need something. These birds are…

Q: In this example, we're going to see what happens when two traits are examined at the same time.…

A: Given information Fur and tail traits are observed at the same time. Dominant traits are black fur…

Q: Noncyclic photophosphorylation involves a constant source of new electrons. b. production of…

A: Photophosphorylation: It is conversion of ADP to ATP using the energy of sunlight by activation of…

Q: Remember for T/F questions, either answer TRUE or FALSE, but if the answer is FALSE make sure to…

A: Unlike bacterial RNA polymerase, the eukaryotic RNA polymerase cannot initiate transcription in…

Q: Which of the following is correct about feedback systems? O Positive feedback systems resist change…

A: Homeostasis refers to the process of maintaining internal physiological parameters in a changing…

Q: Which antibiotic would you want to take based on the results found in the table? I would take…

A: Zone Of Inhibition: A Zone of Inhibition Test, commonly known as a Kirby-Bauer Test, is a…

Q: Give two reasons why a point mutation in the codon for methionine (Met) would likely be more serious…

A: Point mutation is a mutation where a single nucleotide is changed i.e. insertion, deletion or…

Q: Transcribe and Translate the origininal DNA sequence, then in mutated dna sequence identify the Mrna…

A: Since you have asked the multipart question, we will solve the first three questions for you. If you…