Which change is most likely to directly interfere with cytokinesis in a dividing animal cell? The loss of a lysine residue in a histone protein A mutation that affects the G2–M cyclin-CDK complex A mutation in the gene that encodes actin A mutation that affects the S cyclin–CDK complex A mutation in the RB gene

Which change is most likely to directly interfere with cytokinesis in a dividing animal cell? The loss of a lysine residue in a histone protein A mutation that affects the G2–M cyclin-CDK complex A mutation in the gene that encodes actin A mutation that affects the S cyclin–CDK complex A mutation in the RB gene

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter9: Cell Communication

Section: Chapter Questions

Problem 2VCQ: Figure 9.10 In certain cancers, the GTPase activity of the RAS G-protein is inhibited. This means...

See similar textbooks

Similar questions

What factors called mitogens stim-ulate cultured mammalian cells to proliferate by inducing expression of early response genes. Many of these genesencode transcription factors that stimulate expression ofgenes encoding the G1/S phase cyclins and E2F transcriptionfactors.
Cyclin D/cdk 4,6 inhibits retinoblastoma protein (Rb) binding to...., which ultimately affects gene expression. cycling-dependent kinase tramscription factor E2F p53 oncogenes
Predict the effects of the following mutations on the ability of a cell to undergo apoptosis:a. Mutation in Bad such that it cannot be phosphorylated by protein kinase B (PKB)b. Overexpression of Bcl-2c. Mutation in Bax such that it cannot form homodimersOne common characteristic of cancer cells is a loss of function in the apoptotic pathway. Which of the mutations listed above might you expect to find in some cancer cells?
Put the following steps in the correct orderedsequence.a. kinase cascadeb. activation of a transcription factorc. hormone binds transmembrane receptord. expression of target genes in the nucleuse. Ras molecular switch
What would be the effect on the cell cycle if a cell acquired a mutation that rendered each of the following domains inactive? Explain your reasoning. The PSTAIR region of an M-phase Cdk The Wee1 Kinase The kinase that normally phosphorylates Sic 1 The Sic1 cyclin-Cdk inhibitor
In attempting to design a drug that will impede cell cycle progression in ovarian cancers cells. you will want the drug to have this effect on the cells; Group of answer choices Increase expression of CDK7 Increase the phosphorylation of the ATP-binding pocket of CDK1 Increase expression of CDC25A All of these
What statement about Cdks/Cyclins below is false? A) Cyclins phosphorylate Cdks B) Cdks are kinases C) Cdk expression is constant during the cell cycle D) Cyclin expression fluctuates during the cell cycle E) Cdk activity fluctuates during the cell cycle
Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA? A. Break point cluster region protein that may function as a GTPase B. A coagulation factor C. An enzyme involved in the breakdown of glycosaminoglycans (GAGs) D. Transcription factor involved in the DNA damage response E. A component of hemoglobin F. A tyrosine kinase G. Serine/threonine kinase involved in the DNA damage response H. A tumor suppressor involved in WNT signalling I. A DNA repair enzyme involved in nucleotide excision repair
You are researching the regulation of cell-size control and discover that a signaling pathway that acts through a particular enzyme-coupled receptor is important for the size growth (enlargement) of rat kidney cells. Receptor activation causes activation of adenylyl cyclase, which ultimately leads to the activation of PKA. PKA then phosphorylates a transcription factor called BTS on threonine 84. This phosphorylation is required to allow BTS to bind to specific regulatory DNA sequences, increasing the transcription of Zrt2, a gene encoding a protein vital for kidney cell growth. You find that kidney cells without this receptor are 25% smaller than normal cells. When you measure cells expressing a constitutively active version of PKA, you find they are 25% bigger than normal kidney cells. Based on these results, predict whether a kidney cell’s size would be bigger or smaller than normal kidney cells in each of the following circumstances. Explain why in 1-2 sentences for each. You…
You are researching the regulation of cell-size control and discover that a signaling pathway that acts through a particular enzyme-coupled receptor is important for the size growth (enlargement) of rat kidney cells. Receptor activation causes activation of adenylyl cyclase, which ultimately leads to the activation of PKA. PKA then phosphorylates a transcription factor called BTS on threonine 84. This phosphorylation is required to allow BTS to bind to specific regulatory DNA sequences, increasing the transcription of Zrt2, a gene encoding a protein vital for kidney cell growth. You find that kidney cells without this receptor are 25% smaller than normal cells. When you measure cells expressing a constitutively active version of PKA, you find they are 25% bigger than normal kidney cells. Based on these results, predict whether a kidney cell’s size would be bigger or smaller than normal kidney cells in each of the following circumstances. Explain why in 1-2 sentences for each. You add…
Which of the following consequences of mutations would likely to be associated with an increased cancer risk? (select all that apply)? A. Truncation of the EGF receptor B. Constitutive activation of K-Ras C. Amplification of myc D. Truncation of H-Ras due to a premature stop codon E. Amplification of ErbB2
Which protein is a positive regulator that phosphorylates other proteins when activated? a. p53 b. retinoblastoma protein (Rb) c. cyclin d. cyclin-dependent kinase (Cdk)