Which is not true about our heart A. ventricular systole squeezes blood to the lungs and the body B. Both ventricles hold the same volume of blood C. The pacemaker is in the right atrium D. blood from the left lung goes to the left atrium and blood from the right lung goes to the right atrium

Which is not true about our heart A. ventricular systole squeezes blood to the lungs and the body B. Both ventricles hold the same volume of blood C. The pacemaker is in the right atrium D. blood from the left lung goes to the left atrium and blood from the right lung goes to the right atrium

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter39: The Respiratory System

Section: Chapter Questions

Problem 2VCQ: Figure 39.13 Which of the following statements is false? In the tissues, PO2 drops as blood passes...

See similar textbooks

Related questions

Q: You are living through history due to the Covid-19 pandemic and now have real-world experience relat...

A: COVID-19 is the biggest global event and challenge of our lifetimes, Mostly this pandemic has left o...

Q: coenzyme and cofactor

A: Coenzymes are small, non-protein organic molecules that carry chemical groups between enzymes . Cofa...

Q: 1. How do the larval forms of the trematodes and the cestodes differ? 2. How do their life cycles di...

A: Cestodes and Trematodes are the two Classes of Phylum Platyhelminthes.

Q: If a species looks superficially the same after thousands of years, the most likely explanation is: ...

A: Introduction:- Convergent Evolution occurs when thousands of years pass and a species appears to be ...

Q: Lynx mate in March and have litters of 3 to 5 kittens in May. Lynx kittens are born blind and naked....

A: Introduction Nocturnality refers to an animal's habit of being active at night and sleeping during t...

Q: What type of biome do you live in? (If you live in adeveloped area, what type of biome was the area ...

A: Humans can be found living in virtually all types of terrestrial biomes. Of Earth's, 6.4 billion hum...

Q: . An oligonucleotide (a short DNA or RNA) has the following sequence: ACGTGGTTCCATGGTACGGC (a) Show ...

A: The malting temperature (Tm) of the DNA is the temperature at which at least 50% of dsDNA is conver...

Q: Let's start with a little phylogeny! What features are at this node? The node is a branching point t...

A: Branch point or node shows the divergence of two species into respective descendants. All the descen...

Q: 1. Your roommate has noticed that you now spend most of your time studyingmicrobiology and has becom...

Q: Question 3 A disease's basic reproductive rate, Ro-S BL. where S is the density of susceptible indiv...

A: * SIR model ( susceptible, infectious and recovery) * Sir model is used to determine the the transmi...

Q: i need help finding the right answers

A: The nucleotide polymers that are responsible for determining and the regulating the genetic characte...

Q: The white arrow is pointing to the [Select] According to the vide commonly confused with the v[ Sele...

A: The human body is composed of different organ systems. These organ systems perform specific physiolo...

Q: Swimmers may not pay attention to hydration as compared to runners. Swimmers do not get dehydrated. ...

A: Given: Swimming is tough exercise during which your body sweats in the water. It is like if you were...

Q: 1. Which of the following drugs is not a cardioselective beta-blocker? * A. Esmolol B. Atenolol C. P...

A: Since you have asked multiple question, we will solve the first question for you. If you want any sp...

Q: Table 14. Crossing Fl individual with another Fl individual Individual # 213 252 Gender Male Female ...

A: The answer is NO.

Q: Give an example of a creation myth and explain how its divine being created the universe and the org...

A: Creation Myth: A creation myth (also known as a cosmogonic myth) is a symbolic storey about how the ...

Q: What is the name of the LT receptor which recognize the hla molecules of the graft

A: Introduction:- The human leukocyte antigen (HLA) system (also known as the major histocompatibility ...

Q: Identify a non-competitive inhibitor and the enzyme that it impacts. Describe how the competitive in...

A: Enzymatic activity turned up or down by activator and inhibitor molecules tat bind specifically to t...

Q: Define the following terms that are commonly used describe colonies: 1. Form - 2. Elevation - ...

A: In microbiology, colony is a group of fungi, bacteria and other micro-organisms which grows on sol...

Q: Solutes tend to diffuse from a region where they ar_____ concentrated to an adjacent region where th...

Q: What are morphological structures of flatworms?

A: Flatworms are the soft-shell bodied, much flattened acoelomate worms, such as tapeworms, flukes etc....

Q: PART I. THE THEORY OF EVOLUTION. DIRECTIONS: Complete the paragraph about evidence of evolution by c...

A: Introduction :- The theory of evolution is founded on the assumption that all species are connected ...

Q: As a scientist, you need to develop an antiviral drug that will affect the attachment of bacteriopha...

A: The T phages are infectious phages that is capable of infecting Escherichia coli. They are lytic ph...

Q: 1OOking at a standard Wright Fisher moder with 2N 20 haploid individuals, how many OFFSpring do you ...

A: The wright - fisher model describes a population with non-overlapping , In each generation entire po...

Q: Swimming just like any other exercise is accompanied by some risks of accidents. Therefore, it shoul...

A: Swimming ie considered as one of the main physical activities for making someone fit, both mentally ...

Q: Describe the gross structure of a skeletal muscle.

A: The muscles with alternate light and dark bands which remain associated with the skeleton and can co...

Q: A study by the CDC reported that only 73% of children in some areas of the United States are being a...

A: Vaccination is the procedure of injecting a lesser pathogen or a disease's weakened antigen into a h...

Q: which lampreys are native and which are invasive to the Great Lakes?

A: Sea Lamprey are native and which are invasive to the Great Lakes. The earliest sighting of a sea lam...

Q: Why are males more prone to having x-linked recessive disorders? a. Because the y chromosome is sma...

Q: Explain why you are for or against (a) raising theprice of water while providing lower lifeline rate...

A: Introduction Water is a molecule made up of two hydrogen atoms joined by a covalent link to the cent...

Q: In cats, fur color is a sex-linked trait, where black fur is dominant over yellow fur. If a calico f...

A: The coat color of cat is an X-linked trait. Males are hemizygous (one X chromosome and another Y ch...

Q: why is it important for all somatic cells to be genetically identical?

A: Except for sperm and egg cells, a somatic cell is any cell in the body. Somatic cells are diploid, w...

Q: What is the morphology of the following cells: sarcina tetrad diplococci ...

A: Bacteria are ubiquitous microscopic prokaryotic organisms which neither possess true nucleus nor mem...

Q: 1. What makes them similar and different to one another? 2. Compare and contrast their characterist...

A: Mushroom: A mushroom is the reproductive structure produced by some fungi. Mushroom belongs to the ...

Q: 2 3 4 5 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 ху Which chromosome set has an extra What diagn...

A: The first set has an extra chromosome. The patient suffers from aneuploidy. As the genome contains o...

Q: A tree grows and increases its mass. Explain why thisis not a violation of the law of conservation o...

A: Atoms are the smallest things that are designed to be considered as the basic building blocks of the...

Q: The solid black line represents the backbone of the protein. Functional groups 1 and 2 are [ Select]...

A: Q. The solid black line represents the backbone of the protein. Functional groups 1 and 2 are • a...

Q: Which level(s) of protein structure can you find the a helix and the B pleated sheet? CHECK ALL THAT...

A: Introduction:- A protein molecule is much larger than a sugar or salt molecule, and it is made up of...

Q: What type of mutation causes the "mutant" variety of the PTC gene? a A point mutation which lead t...

A: PTC gene: it is the premature translation-termination codon. PTC is responsible for about one third ...

Q: Which of the following are essential characteristics of RNA? (Not characteristics that are typical, ...

A: Presence of uracil defines a nucleic acid structure to be an RNA. Being single stranded is not a fea...

Q: Describe the fluid mosaic model of cell membrane structure.

A: The cell membrane is also called as plasma membrane, it is membrane which is separate interior envir...

Q: A geneticist is using a three-point testcross to map three linked Drosophila recessive mutations cal...

A: Testcross progeny phenotype Number Crossover Curved 281 Parental Anomalous, Buckled 279 Par...

Q: What are the three big ideas of this chapter? Explainhow making the transition to more sustainable f...

A: "ANSWER An estimated 1 billion people suffer from malnutrition. Modern industrial agriculture harm...

Q: What is the relationship between the free energy of supercoiling and the superhelical density? How d...

A: Deoxyribonucleic acid (DNA) is a compound made up of two nucleotide bases which wrap around together...

Q: Using the images provided below, develop your own dichotomous key through the format given. An examp...

A: The system by which scientists classify living species is known as biological categorization. Simila...

Q: Considering the results of recent nutrition research, what recommendations do you think will be inco...

A: Answer

Q: answer

A: Solution : 65) correct option is a In Juvenile ecosystem zoocenoses is monophagus.

Q: 1. In addition to the ABO blood group, many others have been identified in humans. One such group is...

A: MN blood group is under control of an autosomal locus . This blood group has two alleles LM and LN t...

Q: Define natural capital. Define natural resourcesand ecosystem services, and give two examples ofeach...

A: "ANSWER Natural capital refers to natural assets that provide natural resource inputs and environm...

Q: If the sequence of mRNA is 5'-AAUCGUACGGAUGCCGAAAUACCCAUUAGGGAUUGCAUAGCGAGCAACGGAC-3', what is the a...

A: Protein is the final product of a gene that determine the phenotype of the organism. Protein synthes...

Question

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

In the systemic circuit, the hearts _______ half pumps blood to all body regions; then blood flows to the heart. a. left; deoxygenated; oxygenated b. right; deoxygenated; oxygenated c. left; oxygenated; deoxygenated d. right; oxygenated; deoxygenated
After oxygen diffuses into lung capillaries, it also diffuses into _______ and binds with _______. a. tissue fluid; red blood cells b. tissue fluid; carbon dioxide c. red blood cells; hemoglobin d. red blood cells; carbon dioxide
Visit this site (http://openstaxcollege.org/l/heartvalve) to observe an echocardiogram of actual heart valves opening and closing. Although much of the heart has been removed from this gif loop so the chordae tendineae are not visible, why is their presence more critical for the atrioventricular valves (tricuspid and mitral) than the semilunar (aortic and pulmonary) valves?
How do arteries differ from veins? a. Arteries have thicker wall layers to accommodate the changes in pressure from the baa b. Arteries carry blood. c. Arteries have thinner wall layers and valves and move blood by the action of skeletal muscla d. Arteries are thin wafted and are used for gas exchange.
Figure 40.10 Which of the following statements about the circulatory system is false? Blood in the pulmonary vein is deoxygenated. Blood in the inferior vena cava is deoxygenated. Blood in the pulmonary artery is deoxygenated. Blood in the aorta is oxygenated.
Contraction of _______ drives the flow of blood through the aorta and pulmonary arteries. a. atria b. veins c. arterioles d. Ventricles
The heartbeat includes: a. the systole when the heart relaxes and fills. b. the diastole when the heart contracts and empties. c. pressure that causes the AV valves to open, filling the ventricles. d. rising pressure in the ventricles to open the AV valves and close the SL valves. e. the lub sound when the SL valves open and the dub sound when the AV valves close.
Figure 16.10 Which of the following statements about the circulatory system is false? a. Blood in the pulmonary vein is deoxygenated. b. Blood in the inferior vena cava is deoxygenated. c. Blood in the pulmonary artery is deoxygenated. d. Blood in the aorta is oxygenated.
Figure 39.13 Which of the following statements is false? In the tissues, PO2 drops as blood passes from the arteries to the veins, while PCO2 increases. Blood travels from the lungs to the heart to body tissues, then back to the heart, then the lungs. Blood travels from the lungs to the heart to body tissues, then back to the lungs, then the heart. PO2 is higher in air than in the lungs.
Figure 40.11 Which of the following statements about the heart is false? The mitral valve separates the left ventricle from the left atrium. Blood travels through the bicuspid valve to the left atrium. Both the aortic and the pulmonary valves are semilunar valves. The mitral valve is an atrioventricular valve.
Where does the right ventricle send blood? a. the head b. the upper body c. the lungs d. the lower body