Which of the following accurately describes the inducibility of adaptive immunity? A)  a given immune response acts against a specific antigen possessed by a pathogen B)  both cells and antibodies are involved in immune responses C)  immune cells acting against a given pathogen increase greatly in number upon encountering that pathogen D)  immune responses against the body's own molecules do not normally occur E)  pathogens stimulate cells involved in adaptive immunity

Q: In photosynthesis, Select one: Oa. CO2 is split to create NADPH Ob. water is made to create NADP Oc.…

A: Introduction: The green components of the plant,  blue/green compound called chlorophyll A and a…

Q: Your friend is intrigued by Cdks and purifies Cdk from the daisy plant. She is able to determine the…

A: Protein-protein interactions frequently include conserved amino acid sequences. Here we need to find…

Q: Question 25 Which of the following would you expect to see when comparing the genomes of two…

A: Our genome is made up of about 3 billion base pairs of DNA that make us who we are. DNA sequences…

Q: What prevents the lakes of colder parts of the world from freezing solid from bottom up? Water in…

A: Warm water generally gets more dense as it gets colder, and therefore sinks. This fact may lead you…

Q: Use the following data to calculate the original bacterial sample. 1 ml Sample of E. coli 1/10 OF-10…

A: Bacteria is a ubiquitous microscopic prokaryotic organisms which does not contain true nucleus and…

Q: List two preparations shown every month by the uterus in anticipation of pregnancy in humans.

A: The systems in a woman's body that are connected to the development of an ovum for fertilisation…

Q: Sponges that are unpalatable have a more limited capacity for regeneration. This is an example of a:…

A: Incumbent - A well developed species becomes extinct due to adverse condition and its vacated niche…

Q: Complete the labels for the following diagram of translation. NOTE: A is the product of this…

A: Translation is the second step of gene expression in which information from mRNA is encoded into the…

Q: Cystic fibrosis is an autosomal recessive disorder. The frequency of CF in Ontario is 1 in 3,000.…

A: In the given case, the frequency of population having homozygous dominant, homozygous recessive and…

Q: Plant hormones

A: Introduction: Plants need a lot of natural support for their existence and growth, including water,…

Q: Some non-plant organisms like the protist that spreads malaria contain a non-photosynthetic…

A: Apicoplasts is a vestigial non photosynthetic plastid found in parasites under phylum…

Q: The experimental growth of an eye on the leg of a fruit fly is most famous for providing direct…

A: A gene has been identified on the fruit flies called "eyeless gene".  It can be turned on different…

Q: What characteristic unites the Apterygota? shared morphological adaptations for ectoparasitism…

A: The subphylum Hexapoda, which includes insects and the wingless and ametabolous Entognatha class of…

Q: 4.3. Calculate the carbon dioxide volume expired during one hour by person performing the physical…

A: ANSWER) Volume of air expired in one expiration is 500mL. Number of breaths in one minute in normal…

Q: Puting a metabolic pathway map together which includes glycolysis, gluconeogenesis, glycogen…

A: Glycolysis is the process of oxidation of glucose to pyruvate, while glycogenolysis is the breaking…

Q: You have found a plant-derived compound that interferes with microtubule assembly by binding to and…

A: Mitotic inhibitors prevent the tubulin from being assembled and disassembled into microtubule…

Q: A liver cell in a crocodile contains 32 chromosomes. Which of the following correctly shows the…

A: Introduction: The thread-like components known as chromosomes are found in the nucleus of both…

Q: What is mutagenesis and what does it do ?

A: Solution :- Mutagenesis is the process by which an organism's deoxyribonucleic acids (DNA) change,…

Q: 5. The enzyme that can connect two DNA fragments into one is called: A. DNA polymerase B. DNA ligase…

A: The given question ask about enzyme which is used to join DNA fragments. Second question is about…

Q: Oocytes contain inactivated ______ that become activated soon fertilization.  The mechanism that…

A: An essential step at the beginning of embryo development during fertilization is oocyte activation.…

Q: In monkeys, the D allele produces a calm personality, while the recessive allele, d, results in a…

A: The expression of the gene results in the development of certain phenotypical characters. Genes can…

Q: The multicellular body plan (demonstrated by the Porifera, sponges) are possible because of the…

A: These methods cannot be used to liberate transmembrane proteins, many proteins retained in the…

Q: Ch. 5: Inflammation of the lung, triggered by infectious microbes or aspirated substances or smoke,…

A: Introduction Respiratory disorders affect the lungs of the patient and it leads to difficulties in…

Q: Match enzyme name to (substrate, product) pair. Acyl-CoA dehydrogenase beta-Ketothiolase…

A: Mostly the enzymes belong to beta oxidation category of fatty acids. It occurs in three stages and…

Q: Can you please explain the difference between resource partitioning and resource segregation

A: To prevent competition in an ecological niche, the species distribute scarce resources among…

Q: Parkinson’s disease is a neurodegenerative disease, in which misfolded proteins accumulate.  What…

A: Parkinson's disease is a type of progressive disorder that affects our nervous system and the parts…

Q: pyramid. Explain this pheno An ecologist is doing an in-depth study of a tundra ecosystem. He does a…

A: Given, Producer biomass per square meter is. = 3.5 kg/m2.

Q: More... I Assume that the intrinsic rate of growth is 0.75 for mosquitoes (Family: Culicidae). If…

A: As the first question is incomplete, we will be able to provide answer to the second question only.…

Q: Actin (which makes up the cytoskeleton) is an example of a/an ______.  Hemoglobin is an example of a…

A: All eukaryotic cells contain the highly abundant intracellular protein actin, which is essential for…

Q: Gab junctions are intracellular matrix that

A: Cell junctions are a type of connections that formed between the plasma membranes of two adjacent…

Q: In order to inactivate enzymes involved in cancer, chemists at pharmaceutical companies search for…

A: The enzymes gets inactivated at high temperatures and by changes in pH. These are vague factors that…

Q: In the evolution of the vertebrates , the myocytes provide the stem cells for a) smooth mucscles…

A: The primary component of muscle tissue is the myocyte, often known as the muscle fiber. They are…

Q: Which of the following is an effect of pollution on nutrient cycling of polluted ecosystems? O a.…

A: One of the most common pollution on nutrient cycling of polluted ecosystems is the process of…

Q: B-cells participate in _______ immunity and produce ________   a.   acquired, proteasome…

A: Immunity mediated by humor is mediated by B lymphocytes. The B cell transforms into a plasma cell,…

Q: state any 5 ways of ensuring gender mainstreaming at institutional level

A: Gender mainstreaming is the general public coverage idea of assessing the one-of-a-kind implications…

Q: Six independent phylogenetic trees show that the same character evolved in the ancestor of a…

A: Follow each taxon's lineage back in time (toward the tree's base) until all the lineages converge to…

Q: rate of reaction

A: The molecule upon which an enzyme acts is called a substrate. The chemical reactions involving the…

Q: During our discussion of thermodynamics, you constructed a table that listed several processes,…

A: ATP Hydrolysis: ATP hydrolysis is the breakdown of ATP (adenosine triphosphate) molecules into ADP…

Q: In step 6 of the Krebs cycle succinate ___ to fumerate a reaction that takes place in the ___…

A: Succinate is changed into fumarate in the sixth stage, where two protons are taken out, resulting in…

Q: Ch. 6: Hypophosphatemia would most likely result in a patient: a) having a prolonged QT interval in…

A: Phosphate is one of the most important molecular elements to normal cellular functions within the…

Q: What is the difference between Lantana camara Linn and Lantana camara Mill?

A: Lantana camara Linn. It is both a weed and a popular houseplant. Plants have been used as a source…

Q: Consider the sequence below for amplification: GGCGTAGGCTGATCGTGGGCTCTAGGGGGCTGCTGCTGCTATTATGCTGGC…

A: The polymerase chain reaction (PCR) is a molecular biology technique to amplify a DNA segment of…

Q: 4.4. The indoor air temperature is 25°C according to dry-bulb thermometer and 19°C according to…

A: Indoor equivalent effective temperature (IEET) is a measure of the combined effects of air…

Q: Glycogen stored in muscle and liver is used for following organs in the order: Select one: a.blood,…

A: Note: please always mention the needed parts in case of multiple questions. Thank you! Enzymes are…

Q: In monkeys, the D allele produces a calm personality, while the recessive allele, d, results in a…

A: Disclaimer: Since you have posted a question with multiple sub-parts, we will provide the solution…

Q: Ch. 5: Acute Respiratory Failure (ARF) can arise from all of the following a) spinal cord injury b)…

A: Acute respiratory failure is a sudden inability of the lungs to adequately exchange oxygen for…

Q: The chromosomes in the illustration below are found in a male betta fish and carry the gene for…

A: Mendel proposed the laws of inheritance based on the results of his hybridization experiments. He…

Q: When a protein becomes phosphorylated, it _________ a phosphate group.  This reaction is mediated by…

A: Some of the energy is utilized to generate ATP from ADP and Pi, but ATP is required immediately for…

Q: multiple sclerosis

A: The TAM family of receptor tyrosine kinases (TYRO3 ,AXL and MERTK) have been implicated as important…

Defense Mechanism

Circumstances influence and compel people to behave in a certain way. One such behavior is a defense mechanism. It is employed by people to escape from unpleasant circumstances, thoughts and actions. Defense mechanisms are, thus, psychological strategies that help to avert and avoid unwanted feelings such as guilt or shame and situations such as threat and danger.