Which of the following amino acids is/are ketogenic? A. tyrosine and phenylalanine B.lysine and isoleucine C. threonine and tryptophan D. leucine and lysine

Q: Which of the following amino acids are considered as both glucogenic as well as ketogenic amino…

A: Those organic molecules which possess two functional groups carboxylate and amino group and a…

Q: only two (2) amino acids are purely ketogenic lysine and? OA. Isoleucine B Leucine C. serine O D.…

A: Introduction :- The term "ketogenic" refers to a low-carb diet . You should consume less calories…

Q: Draw the chemical structures resulting from the transamination of the following amino acids: a.…

A: Note: We are authorized to answer three subparts at a time since you have not mentioned which part…

Q: Cysteine and Aspartate: draw the amino acid side chain and give the single and three letter…

A: Proteins are composed of the polypeptide chain, which exhibits the incorporation of amino acids. The…

Q: Create a diagram showing the process of how to make Salivary Amylase.  the diagram can be generic to…

A: Enzymes are special proteins which act as biological catalysts, which are required for the plethora…

Q: Thymidine is the result of A Removal of the ribose-5'-phosphate group from thymidylic acid B Removal…

A: Answer :  a.  Removal of the ribose-5'-phosphate group from thymidylic acid.

Q: Explain the synthesis process of Losartan?  Please answer at your own words

A: The process in the synthesis of losartan are: Alkylation of methanol…

Q: The source of C8 in adenine is from   A. Glycine   B. Aspartate   C. Glutamine   D. Formate

A: Adenine is a nucleic acid base. It is present in Deoxyribonucleic Acid (DNA) and Ribonucleic Acid…

Q: C17H29COOH     linolenic acid     non-saponifiable     ω-3 fatty acid       All are correct

A: Lipids are not polymers. The simplest form of lipid is fatty acids which are a long chain…

Q: The codon chart below shows that adenine-uracil-guanine (AUG) codes for the amino acid methionine,…

A: CENTRAL DOGMA:- The whole process of Central Dogma involves two processes:- 1) Transcription- When…

Q: Reveal the secret message by writing the amino acid sequence into one-letter code: Leu-…

A: Biomolecules are organic molecules made up of mainly carbon and hydrogen but there are other…

Q: Identify the following amino acid (at pH = 7.0): (COO-)–CH(NH3+)–CH2–CH2–CH2–CH2–(NH3+) glutamic…

A: Amino acids are the organic molecule composed of amino group (NH2), an acidic carboxylic group…

Q: Discuss the Pharmacokinetics of morphine sulfate using the correct sequence you  have chosen in…

A: Morphine is a drug that targets a specific type of receptor that affects multiple processes. It does…

Q: The genetic disorder sickle-cell anemia occurs when the amino acid valine takes the place of…

A: Sickle cell anemia is a type of blood related disorder which is also known known as sickle cell…

Q: Cut the following protein with the Serine Proteolytic enzyme Trypsin. How many peptide fragments are…

A: Protein sequencing is an important aspect in the field of proteomics and molecular biology which…

Q: Why Ranitidine is better than Cemitidine? Please explain at your own words.

A: There are several drugs used to treat peptic ulcer disease. Peptic ulcer is characterized by…

Q: Identify the following amino acid at pH = 7 (aqueous form): (COO-)–CH(NH3+)–CH2–(COO-) aspartic…

A: Amino acids are the monomers that build up the protein. They are termed as amino acids because they…

Q: A portion of an unknown enzyme has the amino acid sequence serine phenylalanine - glutamate -…

A: Gene is the sequence of nucleotides that encode a specific protein.

Q: IIT TTC amino acid sanon TTA TTG CTT СТС СТА СТG phenylalanine ATT АТС АТА leucine GTT GTC GTA GTG…

A: Sense strand of DNA- 5'-CATCCAAATTGTTGCCCG-3' Antisense strand of DNA-  3'- GTAGGTTTAACAACGGGC-5'…

Q: The following steps were performed using enzyme cleavage of a peptide to determine its amino acid…

A: Sequence of amino acids in a peptide are determined by treating the peptide with different agents…

Q: Which of the following could be the DNA template for the following protein primary structum…

A: The DNA is transcribed to produce the mRNA which gets translated into protein. Proteins are polymers…

Q: A drug company has decided to use recombinant DNA methods to prepare a modified α1 -antitrypsin that…

A: Amino acids are the organic compounds join to form proteins.

Q: A portion of an unknown enzyme has the amino acid sequence serine – phenylalanine – glutamate –…

A: In Central dogma, DNA is converted into RNA through the process of transcription and RNA is…

Q: Name all the amino acids that cannot exist as zwitterions. Please explain.

A: The amino acid is amphoteric in nature, which means they can react with acid as well as bases. The…

Q: What exactly is a ribozyme? Can you please give me some real-world examples and explain what makes…

A: A ribozyme is an RNA enzyme that catalyzes biochemical reactions and is capable of specific…

Q: Draw the structure of the PTH derivative product you would obtain by Edman degradation of the…

A: Phenyl isothiocynate is the Edman reagent. It reacts with N-terminal amino acid to give phenyl…

Q: The change of one conformation of protein to another is called    a. allosteric transversion b.…

A: Option b Allosteric transition

Q: Why Ranitidine is better than Cemitidine

A: Peptic ulcer disease There are several drugs used to treat peptic ulcer disease. Peptic ulcer is…

Q: Explain what is happening in point A in terms of the form of Alanine. What is point B? Explain what…

A: Alanine is an Amino acid which consists of 2 acidic groups. Hence it is considered as diprotic Amino…

Q: Which amino acid metabolism is affected in Alkaptonuria? a. Phenylalanine b. Histidine c.…

A: Alkaptonuria : Autosomal recessive disorder caused by homogentisate 1,2-dioxygenase enzyme…

Q: Indicate which of the following amino acids are ketogenic and which are glucogenic: a. tyrosine b.…

A: Amino acids are classified into glucogenic and ketogenic based on the type of intermediate that is…

Q: What are the sequences of all the possible tripeptides that contain the amino acids aspartic acid,…

A: The polypeptide chain is made up of amino acids which are joined by the polypeptide chain.

Q: The following are essential amino acids, except; Isoleucine Tryptophan…

A: Proteins are made up of amino acids and each amino acid has different functional group (R- group).…

Q: A C AAA|A|AC|C GACC |G| |ATC B Ix D E Y F -methionine lysine phenyl- alanine leucine alanine głycine…

A: CENTRAL DOGMA-   Replication is the process when DNA replicates itself means it will make copies of…

Q: From the oligopeptide below, write completely the amino acids and/or peptide fragments that resulted…

A: Complete polypeptide sequence (before digestion)   Given polypeptide contains following amino acid…

Q: Write a DNA sequence that would encode the amino acid sequence…

A: In DNA, the hereditary information is contained within the nucleotides called codons that correspond…

Q: A polypeptide is subjected to the following digestion procedures and the fragments are sequenced.…

A: For this question we just need to to know sites of Trypsin and Cynogen Bromide at which they act and…

Q: All are both ketogenic and glucogenic amino acids except   Group of answer choices Tyrosine Arginine…

A: Gluconeogenesis is the process by which some amino acids can be converted into glucose. As a step in…

Q: Translate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3' O…

A: Answer :-                             Met-ala-phe-lys-stop                  DNA…

Q: Which of the following enzymes adds a new amino acid to the growing chain of a protein during…

A: Introduction Protein Translation: the process of reading mRNA and synthesis of a peptide chain of…

Q: Cut the following protein with the Serine Proteolytic enzyme Trypsin. How many peptide fragments are…

A: Proteins are unbranched polymers constructed from 20 standard α-amino acids. They have four levels…

Q: Which of the following is a purely glucogenic amino acid? A. Leucine B. Tyrosine C. Tryptophan D.…

A: Amino acids can be divided into glucogenic, ketogenic and both glucogenic and ketogenic.

Q: Which of following is purely Ketogenic amino acid? a. Tyrosine b. Leucine c. Phenylalanine d.…

A: Amino acids are building blocks of protein. Amino acids are made up of amino group, carboxyl group…

Q: Identify the correct matched protein related disorder * (Please choose one correct answer only)…

A: * kwashiorkor disease is due to inadequate of protein intake symptoms like fatigue, irritability,…

Q: How many cysteines are present in the amino acid sequence you were given? A.45 B.12 C.60 D.10…

A: Cyteines are one of the 20 amino acids which are ribosomally incorporated into proteins. This amino…

Q: A drug company has decided to use recombinant DNA methods to prepare a modified α 1 - antitrypsin…

A: When a drug company is using recombinant DNA method to prepare a modified antitrypsin that is more…

Q: PKU is an abbreviation for what disorder? What are the symptoms of PKU? How can PKU be treated for a…

A: Phenylketonurina is a rare inherited disorder that causes an amino acid called phenylalanine to…

Q: Discuss the potential difficulties of designing a diet to alleviate the symptoms of phenylketonuria.

A: Phenylketonuria is an inborn, autosomal recessive disorder that effects metabolism. The individuals…