A portion of an unknown enzyme has the amino acid sequence serine – phenylalanine – glutamate – lysine. The DNA code for the amino acid sequence of this unknown enzyme is
Q: GCA UGC CGA UAC
A: 1. The tRNA anticodons for the amino acid sequence shown above is - GCA UGC CGA UAC
Q: Which of the following describes the interactions between a codon and an anticodon? A. A codon and…
A: Codon is in mRNA (messenger RNA) and anticodon is in tRNA (transfer RNA).
Q: The source of C8 in adenine is from A. Glycine B. Aspartate C. Glutamine D. Formate
A: Adenine is a nucleic acid base. It is present in Deoxyribonucleic Acid (DNA) and Ribonucleic Acid…
Q: Below is a sequence of mRNA. Use it to answer the questions below. 5' -…
A: The central dogma in both prokaryotic and eukaryotic cell consists of a series of steps including…
Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:
A: This question is based on the functioning of mRNA expression.
Q: Draw the structure of each nucleotide: (a) UMP; (b) dTMP; (c) AMP.
A: Introduction: Nucleotides are chemical compounds that are made up of nucleoside and phosphate. They…
Q: A small section of a gene for a protein has the following nucleotide sequence: TAT CTG GCT GTC CAA…
A: Mutation is defined as the sudden and permanent change in the nucleotide sequence of DNA. Missense…
Q: You may wish to consult the genetic code above to answer the following question. A mutation has…
A: Mutation is the sudden change in the base pair of sequence resulting in altered phenotype. The…
Q: For what reasons is it important to know the structure of a protein? a) Because then you can fold…
A: The proteins are made up of amino acids and the structure of proteins is classified as primary,…
Q: A small section of bacterial enzyme has the amino acid sequence threonine, valine, glycine, and…
A: The process of formation of amino acids from the mRNA sequence is known as translation. mRNA…
Q: A portion of an unknown enzyme has the amino acid sequence serine phenylalanine - glutamate -…
A: Gene is the sequence of nucleotides that encode a specific protein.
Q: A small section of a gene for a protein has the following nucleotide sequence: CTG GGA TCC TAA GGT…
A: A nonsense mutation is one in which the mutation induces the formation of a stop codon which leads…
Q: __________ are composed of a single linear (unbranching) chain of covalently bound amino acids.…
A: Amino acids are known as the building blocks of protein. These are organic compounds mainly composed…
Q: List possible codon sequences for the following amino acids.(a) Val (b) Phe (c) Asn (d) Gly (e) Met
A: Amino acids are coded by trinucleotides sequence is known as the codon. The first two positions in…
Q: Which of the following is most likely to be an RNA nucleotide? a. Adenosine-5'-triphosphate b.…
A: A nucleic acid is a linear polymer of nucleotides that is a component of the cell's information…
Q: Assume the first nucleotide in the sequence is at the +1 position. Transcribe the DNA sequence into…
A: Deoxyribonucleic acid is the genetic material found within a cell's nucleus. Before cell division,…
Q: What amino acid does the codon AGC code for? Use the chart below. Thr (threonine) Arg (arginine)…
A: Genetic code was discovered by crick. It is the sequence of nitrogen bases in mRNA molecule which…
Q: L-Amino-acid oxidase will catalyze reactions of L-amino acids but not of D-amino acids. Which of the…
A: Since you have asked multiple questions, we will answer only first question for you. In order to get…
Q: Which of the following most accurately describes the anticodon? A. Contains a sequence…
A: Anticodon The base sequence of tRNA which pairs with codon of mRNA during translation is called…
Q: Transcribe the following DNA sequence into codons.…
A: Transcription is a process in which there is formation of messenger RNA from the DNA template In…
Q: Give the amino acid sequence with some little explanation please. 5′…
A: Decoding a sequence of bases in mRNA results in the formation of either peptide, polypeptide, or…
Q: A portion of an unknown enzyme has the amino acid sequence leucine – alanine – lysine – tyrosine.…
A:
Q: is the MINIMUM number of tRNA's needed to recognize all of the codons for glutamate (Glu)
A: Deoxyribonucleic Acid (DNA) is made up of four main bases, also known as nucleotides. These are -…
Q: Sequence: AAA UGG CAA Translate the sequence into the correct amino acids. Question 2 options:…
A:
Q: A small section of a gene for a protein has the following nucleotide sequence: GCT CTA GCT ATC TGA…
A: Introduction A silent mutation is a kind of point mutation where the mutation does not affect the…
Q: Even when a gene is available and its sequence of nucleotides is known, chemical studies of the…
A: Proteins are polymers of amino acids which is translated from the mRNA. Gene (DNA) is transcribed…
Q: If the mRNA molecule from your answer to the previous question is going to be translated into a…
A: The gene is the portion of DNA that codes for a specific protein. First, the DNA is converted to…
Q: A. Name 3 nonpolar amino acids found in proteins (give name and 3 letter code) B. Name 2 polar…
A: A) Non-polar amino acids: The side chain comprises mostly of hydrocarbons. B) Polar uncharged amino…
Q: The following segment of DNA codes a protein. The uppercase letters represent exons, the lowercase…
A: Introduction Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum…
Q: Which of the following recognizes the mRNA codon 5' - U A A - 3'?
A: Firstly, information is transferred from the DNA to mRNA by the process known as transcription. Then…
Q: Define the following terms: a. peptidyl transferase center b. GTPase associated region c. 70S…
A: Ribosomes are the molecules that plays an important role in the translation process. The translation…
Q: A small section of a gene for a protein has the following nucleotide sequence: GGC TCG GTA ACA TAC…
A: Mutation: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to…
Q: Determine which amino acid is formed from the following mRNA codon: GUA. a aspartic acid b…
A: Introduction :- Amino acids are the building blocks of proteins. The building blocks of life are…
Q: Refer to the sequence below to answer the following questions. 5’-…
A: DNA is a double-stranded molecule. Each strand has a polarity, such that the 5'-hydroxyl group of…
Q: A C AAA|A|AC|C GACC |G| |ATC B Ix D E Y F -methionine lysine phenyl- alanine leucine alanine głycine…
A: CENTRAL DOGMA- Replication is the process when DNA replicates itself means it will make copies of…
Q: Imagine that a mutation in a DNA molecule results in the codon CCU being changed to CCC. Both of…
A: In genetic code, the following terms have specific meaning. These are- 1. Unambiguous- Genetic code…
Q: Protein synthesis in bacterial cells usually starts with a" A. Alanine Residue B. Formylmethionine…
A: Protein synthesis is a 5 step process (Activation of amino acids, Transfer of amino acids to tRNA,…
Q: Consider an amino acid sequence:…
A: Since you have posted a question with multiple sub-parts, we will solve first three sub-parts for…
Q: The following statements best describe the RNA structure EXCEPT A) the repeating units are…
A: S.No. DNA RNA 1 Deoxyribonucleic Acid. Ribonucleic Acid. 2 Generally double…
Q: What amino acid sequence will be generated, based on the following DNA codon sequence? Did you read…
A:
Q: A G C A A T C C G T C T T G G T C G T T A G G C A G A A C C That strand has mutated. It is now A…
A: Mutation A change in the sequence of DNA bases that may or may not causes serious problem in an…
Q: Define the following terms: a. guanine nucleotide exchange factor (GEF) b. pretranslocation state c.…
A: A) GEF stands for guanine nucleotide exchange factor . Its a groups of protein that activate GTPases…
Q: Use the following sense DNA sequence 5'- ATGTCCTGGTAA-3' to answer the following questions below.…
A: A) The resulting polypeptide from the mutated DNA sequence is- 5'-ATGTCCTGGTAA-3' Sense DNA…
Q: Draw the structure of the first 3 nucleotides in the nucleic acid sequence attaaaggtt tataccttcc…
A: Introduction: A nucleotide consists of a nitrogen base, a pentose sugar, and a phosphate group.
Q: Use the genetic code table. Which amino acid is coded for by only one codon sequence? Second…
A: Ans is.. methionine
Q: Which of the following statements are accurate descriptions of the genetic code? MARK ALL THAT APPLY…
A: Transcription is the process in which the mRNA copied information from DNA for protein synthesis.…
Q: A single base substitution mutation is likely to have a less harmful effect when the base change…
A: A single base substitution mutation is also known as the point mutation which changes a single base…
Q: Translate the following DNA sequence into a sequence of amino acids: TAC TAA GGA. The genetic code
A: Codon is a trinucleotide sequence of nucleic acids which corresponds to specific amino acids.…
The DNA code for the amino acid sequence of this unknown enzyme is
Step by step
Solved in 2 steps
- A portion of an unknown enzyme has the amino acid sequence leucine – alanine – lysine – tyrosine.The DNA code for the amino acid sequence of this unknown enzyme is a. GAC CGA TTC TTA b. GAT CGC TTT ATA c. GAA CGG TAC ATC d. GAG CGU UUU AUGDetermine the identity of the N-terminal amino acid after reconstructing the intact protein. Why is this answer correct and why are the others incorrect? A. Asp B. Ser C. Glu D. IleDefine the following terms: a. peptidyl transferase center b. GTPase associated region c. 70S bacterial ribosome d. decoding center e. Shine–Dalgarno sequence
- Assuming you have determined the sequence of a certain enzyme/protein product, how will you identify its correct DNA sequence (*some codons are redundant or wobbled) using the cDNA library?Which of these mutations would you predict to be most detrimental? Explain your answer. (Refer to a chart of amino acid structures as necessary.) Asp to Glu Asn to Glu Cys to Lys Pro to Gly Val to ThrDescribe the effect of this mutation on the amino acid sequence of the beta-gloving polypeptide chain: effect of mutation on codon, which amino acid was changed (#amino acids from beginning of chain), what was the amino acid change (from which amino acid to which amino acid?) also find the reputable published source to support this information
- Using the genetic code, interpret the following set of nucleotides. AUGGGUCCAUGGCGUAGGCCAAAUGAUGAGGAAUGAA small section of bacterial enzyme has the amino acid sequence arginine, threonine, alanine, and isoleucine.The tRNA anticodons for the amino acid sequence shown above is a. GCA UGC CGA UAC b. GCC UGA CGU UAG c. CGA AGA GCC AUA d. GCG UGG CCC UAAIn protein biosynthesis, the first codon of the new amino acid chain corresponds to: a. C b. D c. Y d. M e. S
- Most codons specify an _________ . a. protein c. amino acid b. polypeptide d. mRNAWhat signal does the chaperone-mediated autophagy pathway of protein degradation use to identify proteins for destruction? a)The amino acid sequence KFERQ b)HSP90 c)The presence of ubiquitin groups d)The amino acid sequence PESTO-linked glycosylation occurs on ___ residues of proteins. a) Serine and Threonine b) Asparagine c) Methionine d) Acidic amino acid residues