Which of the following are the inputs of the light reactions? Choose all that apply. carbon dioxide gas NADP+ ADP+P oxygen gas ATP water O NADPH sunlight
Q: How is UV exposure an example of phenotypic plasticity
A: The ability of a genotype to express different phenotypes depending on its environment is referred t...
Q: Question # 138 A 53-year-old man comes to the office because of difficulty reading fine print over t...
A: B. Lens elasticity is most likely abnormal in this patient. The lens of the eyes needed to see objec...
Q: How are deoxyribonucleoside triphosphates (precursors of daughter DNA strands) and ribonucleoside tr...
A: The nucleic acids are made up of pentose sugar, nitrogenous base and phosphate molecule. The group o...
Q: Describe an electrochemical sensor assay method for rapid bacterial detection and identification. Wh...
A: Electrochemical sensors work on the principle of sensing, recognition and production of electrical s...
Q: What insects are expected to have the most sclerotized heads? Explain. Does an exoskeleton have an i...
A: The epicuticle, a thin protein coating on the outside, and the procuticle, a thick chitin–protein la...
Q: You are a genetic counselor, and you received the following pedigree to analyze. You must determine ...
A: In this following pedigree shows total 3 generation, 13 family members where 10 members are affected...
Q: How Small Noncoding RNAs Play Regulatory Roles in Bacteria ?
A: Small RNAs (sRNAs) influence gene expression via base pairing with mRNA after transcription. The int...
Q: sars-coV-2 spike protien what is the isoelectric point of this peptide? VGIYLQKTSDHRPEFALAMN
A: ANSWER;- In order to the logical examination on the extreme intense respiratory disorder Covid 2 (SA...
Q: Select all the statements that provide evidence that DNA is the genetic material. Check All That App...
A: The eukaryote chromosome is linear and contains both DNA and protein, and both are found in equal ma...
Q: You calculate an interference value of 0.59. What does this number tell you? a. You will not observe...
A: Answer: (C) you will observe 41% of double crossover.
Q: Nde I EcoR I Sal I KpnI BamH I PUST MCS ori Xho I Amp BamH I Kpn I EcoR I BamH gene W pn BamH I Xho ...
A: Gene insertion is that the addition of one or a lot of genes into a desoxyribonucleic acid sequence,...
Q: Myoglobin is a carbohydrate which in normally found in muscle tissue. True False Chromatin is compos...
A: It specifies a single polypeptide chain with one oxygen binding site. Myoglobin has a heme prostheti...
Q: Energy is released reactants This graph shows an reaction. AG < 0 products Time Gibbs Free Energy
A: The chemical reactions involve the exchange of energy. The reaction can either absorb or release ene...
Q: Trace the flow of hemolymph circulation in the insect circulatory system. Be able to explain how nor...
A: Insects, like all other arthropods, have an open circulatory system that differs from the closed cir...
Q: NERVOUS SYSTEM PATIENT TERMS ASSIGNMENT Identify the medical term for the following patient describe...
A: Nervous system disorder: Structural disorders in neurons present in brain , such as brain or spinal ...
Q: What are the factors which need to be considered in the selection of culture vessel?
A: Culture vessels:- Culture vessels provide a contamination barrier to protect the cultures from the e...
Q: 1b. If the undertermination thesis is false, then scientific theories can be deduced from observatio...
A: Undetermination thesis It is a thesis that states that for each scientifically established hypothesi...
Q: w humans caused the lion fish inva
A:
Q: One of the biggest drawbacks of cell culture is the amount of time and materials required to produce...
A: Answer :- By and large, the most widely recognized issues incorporate strange development designs or...
Q: What is the most likely order of the linked genes R, S, and T if the distance between R and S is 22 ...
A: The above scenario based on linkage and maping.
Q: . identify the overall functions and significance of these systems in maintaining homeostasis 3. des...
A: Homeostasis is the state of equilibrium inside a system that allows it to function under a range of ...
Q: Complete the sentences relating to organogenesis, matching the first part of the sentence on the lef...
A: Ans) 1.Formation of heart tubes involves -B.mesenchyme to epithelial transition 2.Formation of the n...
Q: Describe phosphorylation and give an example
A: Phosphorylation is classified as a biochemical process. This biochemical process comprises attachmen...
Q: What are the functions of the cardiovascular system?
A: The cardiovascular system consists of the heart, blood vessels, and blood. Its primary function is t...
Q: How many strutures are found in an animal call
A: Animal cells can range in size from a few millimetres to a few centimetres. The ostrich egg is the l...
Q: Explain what is meant by the term homologous chromosomes ?
A: Chromosomes are condensed forms of chromatin that are visible during cell division. They were found ...
Q: An Hfr strain of E. coli that is pro thr * leu * lac " was "mated" with an F- strain that is pro thr...
A: Introduction Genetic recombination is a process of exchange of genetic material between two differen...
Q: Name the algae that shown in pic.
A: There are several filamentous algae and the examples include Spirogyra, Nodularia, Anabaena, Oscilla...
Q: 1. identify and describe the basic structures forming the digestive, respiratory and circulatory sys...
A: Homeostasis is the state of equilibrium inside a system that allows it to function under a range of ...
Q: Explain the mechanism by which cells sample extracellular fluid.
A: Extracellular fluid refers to bodily fluid that is not contained within cells. It can be present in ...
Q: the effects of a single allele (A2) on fitness in two populations of the same plant species, Populat...
A: The average excess of fitness is a measure of the fitness of a particular allele (Say aA2). It can b...
Q: If the cloning was successful and the plasmid contained the elements needed for blue-white screening...
A: The screening of transformants after the cloning is a critical step as it allows the identification ...
Q: For the following Chi-square table, how many degrees of freedom should be used when calculating the ...
A: Introduction: The chi-square degrees of freedom are determined using the formula df = (r-1)(c-1), w...
Q: What role does understanding the origins of the insect alimentary canal have in comprehending each d...
A: INTRODUCTION In insects, their digestive system make their nutrients and other sources of s...
Q: What the grandparents' genotypes are? Why doesn’t the father (II-1) have the disease breast cancer?...
A: Genetic inheritance is the process by which genetic information is passed from the parents to the pr...
Q: How are these examples of phenotypic plasticity? 1. Haman weight 2. UV exposure 3. Flower color/pH
A: Answer :- 1. Human weight :- Phenotype is the noticeable physical or biochemical qualities of a in...
Q: Describe natural selection and give natural selection at work in a population an example of
A: The process through which the well-known stated that the term which is the populations of living cre...
Q: What types of gametes are formed by the following genotypes? All gene pairs are segregating independ...
A: The number of gametes formed is determined by the number of heterozygous alleles present within the ...
Q: What is the value of the 2-hour postprandial blood sugar level above which the dose of an oral antid...
A: A post prandial blood sugar of more than 200 mg/dL is considered DIAGNOSTIC of Diabetes Mellitus and...
Q: Translate this RNA transcript: 5' - UUUCUUAUGUGUCGCCGUAAUUGAUAUUAC - 3'. O Phe-Leu-Met-Cys-Arg-Arg-I...
A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: Tra...
Q: In cyclic photophosphorylation, an electron in P700 is excited by a photon and begins to taking the ...
A: The light reaction of photosynthesis involves production of ATP and NADPH by using sunlight. In this...
Q: Explain the relationship between turgor and osmotic pressure
A: Turgor pressure allows the osmotic entry of water through a semipermeable membrane into a cell. This...
Q: Which type of molecule recognizes macromolecules that are present in/on certain groups of pathogens?...
A: Introduction: Phagocytosis is a process in which the phagocytic cells engulf the microbes. It is an ...
Q: What is adaptive immunity ?
A: Immunity is a complicated biological system with the ability to recognise and tolerate what belongs ...
Q: Flg. 1. Breast cancer families 1 to 7. Solid circles, females with breast cancer; open circles, fe- ...
A: Solution:- We are given the following probabilities:P(woman will develop breast cancer gene) = 1/10P...
Q: DNA replication
A: Introduction:- DNA, also known as deoxyribonucleic acid, is a nucleic acid molecule. A 5-carbon deox...
Q: 4. (1) How many females and males are affected in this pedigree? (2) Who is the proband? II (3) How ...
A: NOTE-"As per our honor code, we are authorized to answer only one question at a moment. As you have ...
Q: You crossed tall pea plants to another tall pea plants. You collected all the seeds and planted them...
A: Mendel selected pea plants to investigate genetics because they had clearly recognizable characteris...
Q: Describe the smaller and largest living unit of nerve cells
A: "The nervous system" of all animals is made up of unique cells known as neurons, which serve as the ...
Q: F G А C
A: INTRODUCTION The names of the parts of the flower is given below.
Step by step
Solved in 3 steps with 1 images
- Which of the following choices is correct when it comes to the statement as to why photorespiration is an energy-wasting process?a. Due to its very low light requirementb. Due to loss of carbon dioxide that has already been fixedc. Because it utilizes oxygen and ATPd. It requires a high concentration of carbon dioxideIn the linear light reaction... Select one: a.Electrons exiting PSII leave the system when NADP+ reductase adds them to NADP+ b.Electrons exiting PSI leave the system when NADP+ reductase adds them to NADP+ c.Electrons exiting PSI travel down the ETCThe light-dependent reactions do not produce ___. H+ oxygen ATP NADPH glucose
- In cyclic photophosphorylation, NADPH is produced. True FalseFrom which component of the light-dependent reactions does NADPH form most directly? a. photosystem II b. photosystem I c. cytochrome complex d. ATP synthaseWhat are the products of the light-dependent reactions of photosynthesis? Select all that apply. NADPH O2gas ATP Sugars
- Which of the following are the products of the light reactions of photosynthesis. A. Glucose B. Water C. ATP D.NADP E. Light energy F. NADPH G. Carbon dioxide H. OxygenPhotorespiration occurs in _______ plants. a. C3 and CAM b. C4 and CAM c. C3, C4, and CAM d. C3 and C4The function of light reactions is to a. obtain CO2. b. make carbohydrate. c. convert light energy into a usable form of chemical energy. d. regenerate RuBP
- The overall flow of electrons in the light reactions is from a. antenna pigments to the reaction center. b. H2O to CO2. c. photosystem I to photosystem II. d. H2O to NADPH.The main product of fossil fuel combustion is CO 2 , which increases atmospheric CO 2 .Scientists proposed situating algal containers near industrial areas. Considering theprocess of photosynthesis, how does this arrangement make sense to you? Justify yourthought.Which of the following are reactants of the light reactions of photosynthesis. A. Glucose B. Water C. ATP D. NADP E. Light energy F. NADPH G. Carbon dioxide H. Oxygen