Which of the following does NOT describe mutation? * It can lead to the reproductive success and adaptability of an organism to its environment. It creates the same genetic variation in a gene pool. It can affect the phenotype. Any change to an organism's DNA. What period is the first flowering plants? Devonian Triassic Carboniferous Jurassic Darwin's theory of natural selection does not involve the following. EXCEPT: overproduction mutation theory of use and disuse theory of need
Q: What is the main idea of the passage? A study shows that African wild dogs catch about sixteen perce...
A: The main idea of the passage should include the following notions: - Earlier thought was that Afric...
Q: Atropine (I) and Ipratropium bromide (II) are both muscarinic acetylcholine receptor antagonists. Co...
A: Atropine and ipratropium bromide are the drug use to treat pulmonary disorders . Ipratropium synthes...
Q: How and why are avian and human muscles different?
A: Muscles are the the stretchy fiberes made up of soft tissue.
Q: Which item is best dated using the potassium-argon (K-Ar) method? Group of answer choices A: Cave la...
A: The slow decay of potassium 40 into argon is very useful for dating rocks, such as lava, whose age ...
Q: Using the graph in Figure 11-20, determine how many offspring were involved in the hypothetical cros...
A: In human beings, the skin color can be described as an example of polygenic inheritance. In this for...
Q: åre some shapes cells can have that will have a larger surface area than a sphere? To help you answe...
A: As per our company guideline we are supposed to answer only first question or first 3 sub parts of t...
Q: Now you will translate the amino acid sequence for the given tRNA strand. Remember that codons are 3...
A: According to Bartleby guidelines, we are supposed to answer first three subparts in case of multipl...
Q: 3. Domestic Dog breedni ebsla oslynqonom s svoinos ol Insw eyswis leilemoleye A 4. Felis (Feline; Ca...
A: Cladogram is used to find the branches starting from the ancestral generation till the present gener...
Q: Hello, good day. I have a problem answering this question, and I need your help. Hoping for a respon...
A: DNA is stands for Deoxyribonucleic acid.It is a genetical material present in all peoples.Every pers...
Q: Which of the following characteristics of a water-insoluble substar nost important in governing its ...
A: Answer C) lipid solubility
Q: Membrane embedded Proteins: A) Why were the membrane embedded proteins important in the appearance o...
A: Membrane embedded Proteins: A membrane protein is a molecule of protein that is attached to or assoc...
Q: What types of subunits make up a single strand of DNA? How are the subunits linked?
A: Introduction DNA strand is composed of three components: Deoxyribose Sugar Nitrogenous Bases Phosp...
Q: Which reaction normally happens in the regulation of the trp operon when high levels of tryptophan a...
A: The trp repressor controls the trp operon. When coupled to tryptophan, the trp repressor prevents th...
Q: A 35-year-old woman visits her family practitioner for an examination. She has a mean blood pressure...
A: Aortic stenosis is a dysfunctionality in the valve of the heart of an individual. In this condition,...
Q: A reef that receives most of its fish recruits from other reefs and supplies few larvae to other ree...
A: * coral reef coral reef is in water can form of colonies of coral polyps of calcium carbonate.C * Co...
Q: Hypertension increases afterload for the heart which in turn a-decreases Stroke Volume b-increases...
A: Afterload is the pressure that the heart muscles need to work against to eject the blood ventricula...
Q: If the a and b loci are 40 cM apart and an AABB and aabb individual mate: What gametes will the F1 i...
A: The recombinants means the individual form by combination of two different alleles other than parent...
Q: Which of the following G protein subunits activate K+ channels in response to the GPCR for acetylcho...
A: The G protein subunits that activates K+ channels in response to the GPCR for acetylcholine on heart...
Q: 1) Interpret the value of the interference. 2) Map the genes
A: The genes that are located on the same chromosome are considered as linked genes. In this condition ...
Q: 2. Distinguish among inducible, repressible, and constitutive gene operons.
A: An operon is a functional unit of genomic DNA that comprises a collection of genes that are all regu...
Q: a far point of 5 m. Spectacles that enable them to see distant
A: Optical power is the degree to which a lens,mirror or other optical system coverages or diverges lig...
Q: A scientific name contains information about its: * class and family phylum and order genus and spec...
A: 1. Scientific name consists of two words. The first one is called the generic name and the second is...
Q: Gyraulus convexiusculus is the first intermediate host of: Echinostoma ilocanum Fasciola hepatica Op...
A: Gyraulus convexiusculus is a freshwater snail and can behave as an intermediate host of many parasit...
Q: explain how different detergents take out proteins selectively out of membrane.
A: * Detergents are molecules that form hydrophobic-hydrophilic interactions among molecules . *deterg...
Q: Briefly discuss the cardiac cycle. Include what occurs in the atria and the ventricles, oxygen amoun...
A: The heart is a muscular organ that pumps blood through the blood vessels of the circulatory system s...
Q: 36. Which of the following does not make up the cytoskeleton? A. Microfilament B. Intermediate filam...
A: Cytoskeleton is a protein filament system which is present in cytoplasm of eukaryotic cell.
Q: Explain how these polymers are digested and how the products of digestion are used in the human body...
A: The assimilation of starch starts with salivary amylase, yet this action is substantially less signi...
Q: Define about Chromosome Territories ?
A: Chromosomes are condensed thread-like structures found inside the nucleus of eukaryotic cells. It is...
Q: How can you reply to a discussion about animals with special adaptations?
A: The "Ecosystem" is comprised of the interactions of species in a given region with their surrounding...
Q: Simple but creative caption on a poster about noncommunicable diseases caused by having unhealthy li...
A: A non-communicable disease (NCD) is a disease that is not transmitted from one person to another. N...
Q: The long hair of Persian cats is recessive to the short hair of Siamese cats, but the black coat col...
A: Introduction A gene is consisting of a pair of alleles/factors and can be dominant or recessive. A ...
Q: True or false? All traits are inherited in a Mendelianpattern.
A: Introduction A trait, also known as a character state, is a distinct version of an organism's phenot...
Q: What is the application of electrical application in Cell Membrane potential gradient?
A: A cell membrane separates all cells from their surroundings. The cell membrane controls what enters ...
Q: Below is a short segment of DNA molecule. transcribed the DNA codon into mRNA. TACCATGAGAATTGTGGTCAC...
A: Convertion of TACCATGAGAATTGTGGTCACCTTTTT ATGGTACTCTTAACACCAGTGGAAAAA to mRNA is done and results ar...
Q: contrast the embryonic development of the starfish and the sea urchin.
A: NOTE: Kindly repost for other questions. Dear Student as per the guidelines we are supposed to answe...
Q: Briefly discuss the abundance of sarcoplasmic reticulum in skeletal muscle in relation to its locati...
A: The sarcoplasmic reticulum is the major intracellular organelle for controlling the cytosolic calciu...
Q: Explain how protein is made using information from DNA
A: Introduction: DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and...
Q: Refer to question 5. Assuming complete dominance, the F2 generation will show a phenotypic ratio of_...
A: Complete dominance: Diploid organisms frequently carry two alleles of a gene in the most extreme cir...
Q: In what sense is natural selection more an editing process than a creative process?
A: Natural selection is an important step in the process of evolution. It consists of two steps. 1. Pro...
Q: Analyze the provided hypothetical neuronal set-up and its corresponding table which describes each n...
A: Nerve impulses are the key to the brain. They allow neuron to communicate with each other to deliver...
Q: Rates for sexual behavior are typically based on population surveys. What factors might affect the a...
A: Various factors are responsible for variation in sexual behaviour like race, age, gender etc. Cross ...
Q: Genes A and B are 6 map units apart, and A and C are 4 map units apart. Which gene is in the middle ...
A: Centimorgan is also known as a map unit is a unit for measuring genetic linkage. It shows the distan...
Q: Q7. Meselson and Stahl conducted an experiment to prove that the replication of DNA is semi-conserva...
A: The experiment performed by Meselson and Stahl revealed the model of DNA replication.
Q: There are two groups of drugs classified as antagonists of histamine receptor antagonists. The one g...
A: The drug : histamine receptor antagonist Two groups of the drug: Blocks activation of histamine2 (...
Q: 2. If we assume that amygdala-dependent learning uses the same LTP mechanism as the hippocampus, w...
A: Antagonist-mediated NMDA receptor (hypo-functioning) produces excessive excitatory neurotransmitter ...
Q: Give meanings for the following combining forms: 1. adenoid/o 6. nas/o 2. alveol/o 7. or/o 3. bronch...
A: NOTE: Since you have posted multiple questions So we will be solving the first 3 parts for you. As p...
Q: Regarding the sodium potassium pump, I am confused which enzymes are involved in the addition of the...
A:
Q: The colors of chicken feathers follow a codominant pattern. Both Black (B) and White (W) feathers ar...
A:
Q: Whittaker classified the organisms based on what? * O based on the number of cells in its body and t...
A: Taxonomy is the study of organism categorization, it is the grouping (division) of all known species...
Q: If agriculture on once-virgin tropical forest area were to stop, how would you speed-up the process ...
A: Secondary succession It refers to the ecological succession that takes place after the disruption of...
Step by step
Solved in 3 steps
- House sparrows (Maya) were introduced to North America in 1852. Since that time thesparrows have evolved different characteristics in different locations. Sparrow populations inthe north are larger-bodied than sparrow populations in the south. This divergence inpopulations is probably at least partly a result of natural selection: larger-bodied birds canoften survive lower temperatures than smaller-bodied birds can. Colder weather in the northmay select for larger-bodied birds. What type of evolution based on natural selectionaccounts for this observation? Explain your answer.. Some scientists vigorously rejected Darwin’sideas when On the Origin of Species was published. Richard Owen (1860), perhaps the mostrespected biologist in England, wrote (amongmany other objections): “Are all the recognisedorganic forms of the present date, so differentiated, so complex, so superior to conceivableprimordial simplicity of form and structure,as to testify to the effects of Natural Selectioncontinuously operating through untold time?Unquestionably not. The most numerous livingbeings … are precisely those which offer suchsimplicity of form and structure, as best agrees…with that ideal prototype from which…vegetableand animal life might have diverged.” Howmight Darwin, or you, argue against Owen’slogic?Which pattern of evolution is more likely to introduce homoplasies in the relationships between species?A) divergent evolutionB) parallel evolutionC) convergent evolution
- Sympatric speciation by allotetraploidy has been proposed as acommon mechanism for speciation. Let’s suppose you were interestedin the origin of certain grass species in southern California.Experimentally, how would you go about determining if some ofthe grass species are the result of allotetraploidy?DNA-sequencing studies for a gene in two closely relatedspecies produce the following numbers of sites that vary:Synonymous polymorphisms 50Nonsynonymous polymorphisms 20Synonymous species differences 18Nonsynonymous species differences 2Does this result support neutral evolution of the gene?Does it support an adaptive replacement of aminoacids? What explanation would you offer for theobservations?Recent reconstructions of evolutionary history are often dependenton assigning divergence in terms of changes in amino acid ornucleotide sequences. For example, a comparison of cytochromec shows 10 amino acid differences between humans and dogs,24 differences between humans and moths, and 38 differencesbetween humans and yeast. Such data provide no information asto the absolute times of divergence for humans, dogs, moths, andyeast. How might one calibrate the molecular clock to an absolutetime clock? What problems might one encounter in such acalibration?
- A scientist is attempting to a cladogram that shows the evolutionary closeness of three organisms in relation to humansAfter doing DNA analysis, they that the organisms share the following percentages of DNA Organism A and humans share 85% of their DNA Organismn and humans share 80% of their DNA Organism and humans share 90% of their DNA Based on informationwhich order should they go on the cladogram ( related to most related ?Imagine that you are an evolutionary biologist currenyly studying a particular species of snake on an island off the coast of Durban, South Africa and that you have information indicating that1000 years ago, the same species of snakes in that island was observed to exist in a variety of colours (Red blue,yellow green) and that most of the snakes were blue. This same species of snakes and the same mixof colours were also found on the mainland (i.e Kwazulu Natal) Assuming that all the snakes are descended from an ancestral blue snake, explain this change in colour frequency (evolution) as though it were based solely on each of the following processes. a. Natural selection b. Bottleneck effect c. Founder effectWhich of the following is not an example of natural selection? Development of tanned skin in humans Evolution of antibiotic resistance in bacteria Changes in beaks of finches on Daphne Major Industrial melanism in peppered moths
- . A population of red deer were trapped on an island off of England during the last interglacial period. Within 6,000 years, the population evolved from a mean weight of 200 kg toa mean weight of 36 kg. The generation time of red deer is 5 years and the narrow senseheritability of body weight is 0.5. What is the rate of evolutionary change (in Darwins)?Among Natural Selection, Blending Theory, Pangenesis, Cell Theory, Prefomation, and Lamarck’s Theory these concepts what theories are accepted until now?Consider two species that diverged whilegeographically separated but resumed contactbefore reproduction isolation was complete. Predictwhat would happen over time if two species matedindiscriminately and a. hybrid offspring survived and reproducedmore poorly than offspring from intraspecificmating or b. hybrid offspring survived and reproduced aswell as offspring from intraspecific mating.Provide an example for each to illustrate yourpoint.