This is the original strand of DNA: ATG AAG TTT GGC TAA Which option would represent a frameshift mutation due to deletion during replication? ATG UAA GTT TGG CTA A ATG TTT GGC TAA ATG AAG TTT GGC GCA TAA ATG AAG TTG GCT AA

This is the original strand of DNA: ATG AAG TTT GGC TAA Which option would represent a frameshift mutation due to deletion during replication? ATG UAA GTT TGG CTA A ATG TTT GGC TAA ATG AAG TTT GGC GCA TAA ATG AAG TTG GCT AA

Name: This is the original strand of DNA: ATG AAG TTT GGC TAAWhich option wo
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: This is the original strand of DNA: ATG AAG TTT GGC TAAWhich option would represent a frameshift mutation due to deletion during replication?ATG UAA GTT TGG CTA AATG TTT GGC TAAATG AAG TTT GGC GCA TAAATG AAG TTG GCT AA

Concepts of Biology

1st Edition

ISBN:9781938168116

Author:Samantha Fowler, Rebecca Roush, James Wise

Publisher:Samantha Fowler, Rebecca Roush, James Wise

Chapter9: Molecular Biology

Section: Chapter Questions

Problem 5RQ: The initial mechanism for repairing nucleotide errors in DNA is _____. a. mismatch repair b. DNA...

See similar textbooks

Similar questions

The initial mechanism for repairing nucleotide errors in DNA is _____. a. mismatch repair b. DNA polymerase proofreading c. nucleotide excision repair d. thymine dimers
This is the original strand of DNA: ATG AAG TTT GGC TAA Which option would represent a frameshift mutation due to deletion during replication? a. ATG AAG TTT GGC GCA TAA b. ATG UAA GTT TGG CTA A c. ATG TTT GGC TAA d. ATG AAG TTG GCT AA
Using the correct base pairing rules for DNA replication, what would be the complementary strand for the strand TACCGATGC? Multiple Choice TACCGATGC ATGGCTACG None of the answer choices are correct. GCTAGTCGA TTCCGTTCG
This is the original strand of DNA: ATG AAG TTT GGC TAA - what would represent a frameshift mutation due to deletion during replication ?
List the steps in the correct order of DNA mismatch repair in E. coli Group of answer choices a. Mut S; Mut H; Mut L; Mut H cleaves unmethylated new DNA strand b. Mut H; Mut L; Mut S; Mut H cleaves unmethylated nascent DNA strand c. Mut H; Mut S; Mut L; Mut H cleaves unmethylated nascent DNA strand d. Mut L; Mut H; Mut S; Mut H cleaves unmethylated nascent DNA strand
A. Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction of the strand. 5’-AACGGTCCAGTCCAAGTTACG-3’ 2. Below is a segment of DNA that is ready to be replicated. Outline the processes that the segment will go through during replication. Make sure to include the names of the enzymes that are involved. AATTGCCTGCTAGTCTCAG TTAACGGACGATCAGAGTC B. DNA: G T A C G C G T A T A C C G A C A T T C RNA: C A U G C G CAU A U G G C U G U A G Codons: AUG - CGC - AUA -UGG - CUG - UAA Anti-codons: UAC - GCG -UAU - ACC - GAC - AUU Amino acids: Met- Arg - Ile - Try - Leu Using the example above transcribe the following DNA strands into m-RNA and translate that strand into a polypeptide chain identifying the codons, anti-codons and amino acid sequence. 3. DNA: A T A C G A A A T C G C G A T C G C G G C G A T T C G G 4. DNA: T T T A C G G C C A T C A G G C A A T…
Which of the following DNA repair pathways repair DNA double strand breakage that only occur in diving cells?. Please select all correct answers. A. Nucleotide excision repair (NER) B. Mismatch repair (MMR) C. Double- strand break repair(DSBR) D.non- homologous end joining (NHEJ) E. Synthesis-dependent strand annealing(SDSA)
List the steps in correct order of DNA mismatch repair in E. coli Group of answer choices Mut H; Mut L; Mut S; Mut H cleaves unmethylated nascent DNA strand MutH; MutS; Mut L; Mut H cleaves unmethylated nascent DNA strand MutL; MutH; MutS; Mut H cleaves unmethylated nascent DNA strand Mut S; Mut H; Mut L; Mut H cleaves unmethylated new DNA strand
The following DNA sequence is at the start of a DNA strand: 3'—AATTCGAGATTCA—5'. Which of the primer sequences below would be synthesized from this strand by DNA primase to initiate DNA replication? Group of answer choices a 3'—TTAACGTCTAAGT—5' b 3'—UUAAGCUCUAAGU—5' c 5'—TTAACGTCTAAGT—3' d 5'—UUAAGCUCUAAGU—3'
Writing a Full Strand:1. A. Original DNA: CCT ATA TCT CTC TAT ATC TCT CAT ACT GTG TGT CTC TAT Complementary DNA:_______________________________________________________________________ B. Make identical strands of DNA CCT ATA TCT CTC TAT ATC TCT CAT ACT GTG TGT CTC TAT (original) ______________________________________________________________________ (new) _____________________________________________________________________ (new) ______________________________________________________________________ (complementary from 1A)2. A. Original DNA: CCG GAT TTT AAT TAG CTA CTA TCG TAC TAC GTT GGT GCT Complementary DNA: _______________________________________________________________________ B. Make identical strands of DNA CCG GAT TTT AAT TAG CTA CTA TCG TAC TAC GTT GGT GCT (original) _______________________________________________________________________ (new) ________________________________________________________________________ (new)…
A fragment of DNA has the sequence 5'-ATCCGCT-3'. Following DNA replication, the complementary strand is 3'-TAAGCGA-5'. What type of mutation occurred? a. Frameshift b. Transversion c. Pyrimidine dimer d. Transition
. The DNA polymerases are positioned over the following DNA segment (which is part of a much larger molecule) and moving from right to left. If we assume that anOkazaki fragment is made from this segment, what will be the fragment’s sequence? Label its 5′ and 3′ ends. 5′.…CCTTAAGACTAACTACTTACTGGGATC….3′ 3′.…GGAATTCTGATTGATGAATGACCCTAG….5′