Q: Which type of mutation involves only one base pair? a. insertion b. deletion c. inversion d.…
A: A mutation occurs when DNA molecules are copied or replicated, resulting in DNA variants that can be…
Q: Cystic Fibrosis is caused by which of the following? a. Replacement of three nucleotides with a new…
A: Answer is Option c(Deletion of three nucleotides) and explaination is given in the following steps:…
Q: Which of the following point mutations is likely to be the worst for an organism if they happened in…
A: Mutation is a change in genetic sequence or genomic sequence of an organism. This change can be…
Q: Which of the following would be most likely to cause a mutation? A. the addition of nucleotides to…
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: mutation in a gene’s exons is more damaging than a mutation in a genes intron. Do you agree or…
A: DNA sequences consists of two parts exons and introns. Exon is that part of the DNA which directly…
Q: Using sickle cell as an example, give a detailed description of how the effects of a base…
A: Base substitutions are the simplest type of gene-level mutation, and they involve the swapping of…
Q: Adenine was added where Guanine should have been added, this would be an example of a…
A: Mutations are the changes in the DNA sequence of an organism which may or may not affect its…
Q: 1. Below is an amino acid sequence for the following strand of DNA: A G C A A T C C G T C T T G G T…
A: Ans 1 : Point mutation
Q: A small section of a gene for a protein has the following nucleotide sequence: CCT AAG GAT TCA CTT…
A: Introduction A mutation is a change in the DNA sequence that may occur due to incorrect…
Q: The coding strand of DNA in a segment of a gene is as follows:ATG GGC CTT AGC. This strand carries…
A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…
Q: Chargaff studied the composition of DNA from different sources and found that a. the number of…
A: A gene is a fundamental unit of heredity and a succession of nucleotides in DNA or RNA that encodes…
Q: People used to think that the genetic code could be found in proteins, because there are so many.…
A: Genetic code It is defined as the set of rules through which the information in the genetic material…
Q: A mutation occurred that changes the sequence of DNA from: 5’ACGTCATGGATAGTGCGTAAACTA3’ to…
A: Mutations are abrupt changes in DNA only one ways has been changed the original DNA.
Q: Which of the following statements is INCORRECT? a. In simultaneous transcription of mRNA, many…
A: Transcription is the process of the formation of RNA from DNA where DNA is used as a template. The…
Q: Which of the following represents a missense mutation in the DNA coding strand sequence, 5' -…
A: A change in the structure of DNA, known as a mutation, can alter the sequence of amino acids that…
Q: mutations does vitamin D cause in our DNA
A: Vitamin D is one of the important vitamins responsible for strong bones. vitamin D help in…
Q: Which of the following changes is a transition base substitution?a. Adenine is replaced by…
A: The correct answer is (c) Guanine is replaced by adenine.
Q: A transition mutation would be replacing A by
A: Transition mutation is a process in molecular biology and genetics where it refers to point in…
Q: The antiparallel nature of DNA refers to a. its charged phosphate groups. b. the pairing of bases on…
A: DNA is the genetic material in most eukaryotes and few prokaryotes. It is a linear polymer of…
Q: point mutation (SNP) is sufficient to cause a genetic disorder if a. It causes a change at the…
A: SNPs (single nucleotide polymorphisms) are polymorphisms induced by point mutations that result in…
Q: How does UV light affect the hydrogen bonds between Thymine and Adenine? If UV light is harmful to…
A: Ultraviolet light is a form of radiation that is not visible to the human eye. It's in an invisible…
Q: Exon shuffling is a proposal that relates exons in DNA to the repositioning of functional domains in…
A:
Q: A small section of a gene for a protein has the following nucleotide sequence: CTA TCC CCT ACG TCA…
A: A genetic mutation occurs after the formation of the DNA sequence has been altered. Some mutations…
Q: What might be the result of a mutation of DNA in which a triplet code such as UAC now says UAA in…
A: Genetic material is nothing but the sequence of nucleic acids which is called as DNA. It contains…
Q: Now imagine that a mutation occurred at the first G in the DNA sequence above and the G became a C.…
A: Hello, thank you for your question, since you have not mentioned the DNA orientation I am answering…
Q: What is the central dogma of molecular biology? a. DNA is the genetic material. b. Information…
A: Genetic material is nothing but the sequence of nucleic acids which is called as DNA. It contains…
Q: Which of the following is a good definiton of "mutation." A. A change in the nucleotide sequence…
A: Any alteration or change in the nucleotide sequence of DNA is called mutation and this causes…
Q: The coding strand of DNA in a segment of a gene is as follows: ATG GGC CTT AGC. This strand carries…
A: The DNA (deoxyribonucleic acid) duplex consists of a non-template and a template strand. The…
Q: What are the base pairing rules for DNA? Adenine (A) joins to i and Cytosine (C) joins to_ii_.…
A: DNA is a molecule found in the nucleus by Friedrich Meischer in the late 1860s, but its function was…
Q: Which of the following mutations of the DNA sequence TTT TÁC ÁCT would potentially have the least…
A: The genetic information from the DNA is first transcribed into mRNA. The mRNA contains codons, which…
Q: Does a single base-pair substitution in a strand of DNA always result in a new amino acid in the…
A: Transcription is processed to convert DNA into RNA. It is part of the central dogma. It is processed…
Q: What will be the effect of mutation that turns lysine to arginine
A: The mutations occur in genomic DNA but they will reflect in the form of protein sequence and…
Q: Rank the following DNA changes in order from least likely to change a phenotype to most likely to…
A: Conservative replacement is an amino acid is exchanged into another that has similar properties and…
Q: Does a mutation always result in a change of an amino acid sequence in protein? Why?
A: A mutation is the alteration of the nucleotide sequence of the genome which may or may not result in…
Q: Which of the following would explain the formation of double stranded loops in RNAS? A. electronic…
A: Ribonucleic acid (RNA) is a DNA-like molecule. RNA, unlike DNA, is a single-stranded molecule. The…
Q: The A and B forms of DNA A both have 12 base pairs per turn of the helix B are both right handed…
A: DNA or deoxyribonucleic acid is a polymer made up of nucleotides. It is present in a double-stranded…
Q: A term for the coding region of DNA is: ?? (Group of answer choices) A.a nucleotide B. an exon C.an…
A: Deoxyribonucleic acid is a self-replicating molecule that represents the genetic material in most…
Q: A small section of a gene for a protein has the following nucleotide sequence: GGC TCG GTA ACA TAC…
A: Mutation: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to…
Q: The study of the b-globin gene helped establish the one gene-one polypeptide relationship. Which of…
A: Mutation is a random process. It leads to change the nucleotide in a sequence of a gene.
Q: Which of the following statement is correct? a. In insertion mutation, an organic compound insert…
A: Alternation of DNA sequence takes place in mutation which results in change in genotype and…
Q: Which of the following results in the same amino acid in its protein sequence? a. missense mutation…
A:
Q: A mutation caused by a base deamination or a tautomerization is called a a. silent mutation b.…
A: Mutation- any changes in the gene which causes abnormality is known as mutation Deamination-…
Q: What might be the result of a mutation of DNA in which a triplet code such as UAC now says UAA in…
A: Mutation is the change in the DNA which may cause the change in the amino acid of the protein.…
Q: Which of the following is a transition mutation? OC--> G OC --> T OC --> A
A: Transition is a point mutation where replacement of base pair occurs.
Q: A G C A A T C C G T C T T G G T C G T T A G G C A G A A C C That strand has mutated. It is now A…
A: Mutation A change in the sequence of DNA bases that may or may not causes serious problem in an…
Q: The formation of pyrimidine dimers results from which of the following? a. Spontaneous errors by…
A: Pyrimidine dimers cause mutations in the DNA. When two thymine residues in the same strand form…
Q: A protein was mutated at amino acid position 129. Which of the following mutations will least effect…
A: The correct answer for this question is option- (d) R mutated to D
Q: At the DNA level, a mutation in a protein coding region where a single base is replaced by another…
A: Mutation is the abrupt change that occurs in the sequence of DNA resulting In altered phenotype.…
Q: A DNA sequence can be represented as a string of the letters ACTG (short for adenine, cytosine,…
A: Genome is not a static entity. It is dynamic in nature. It is subject to different types of…
Which of the following mutations is most likely?
a. |
Cytosine to Adenine |
|
b. |
Guanine to Adenine |
|
c. |
Thymine to Adenine |
|
d. |
All equally likely |
Step by step
Solved in 2 steps
- a mutation in dna that adds +1 ot -1 nucleotide or +2 or -2 nucleotides is called a______? (choose one answer only) A. frameshift mutation B. silent mutation C. nonsense mutation D. missense mutationWhich of the following results in the same amino acid in its protein sequence? a. missense mutation b. sense mutation c. nonsense mutation d. antisense mutationWhich of the following mutations is likely to be the least harmful? A. A +1 frameshift mutation B. A +3 frameshift mutation C. A - 5 frameshift mutation D. A -1 frameshift mutation E. A point mutation in the first position of the codon
- Which type of point mutation does not affect the resulting protein? a deletion b missense mutation c silent mutation d nonsense mutationHow do we call the type of point mutation in which an A->U change occurs in the codon for the sixth amino acid in hemoglobin chain b? a) Inversion b) Transversion c) Transition d) TransaminationSuch as in the case of sickle-cell disease, which of the following can occur from the mutation of just a single nucleotide pair in an organism’s DNA? a. Altered mRNA strands b. Altered primary protein structure c. Altered tertiary protein structure d. Altered protein function e. All of the above
- _____ is a change in the order of one nucleotide in a section of a DNA molecule. a Point mutation b Spontaneous mutation c Somatic mutation d Germ mutationThe action of ultraviolet radiation on DNA to induce mutation is the Select one: a. methylation of base pairs b. deletion of base pairs c. formation of thymine dimers d. addition of base pairsCystic Fibrosis is caused by which of the following? a. Replacement of three nucleotides with a new three nucleotide sequence b. Addition of three nucleotides c. Deletion of three nucleotides
- A mutation is most often cause by which of the following factors? a) Sunlight b) Smoking c) Random Copy error d) RadiationA mutation caused by a base deamination or a tautomerization is called a a. silent mutation b. transition mutation c. nonsense mutation d. missense mutationWhich type of mutation produces the same protein despite a change in the DNA? A. nonsense B. missense C. silent D. frameshift