Now imagine that a mutation occurred at the first G in the DNA sequence above and the G became a C. How would this affect the mRNA and the amino acid for that codon? Old DNA codon Old RNA codon Old amino acid New DNA codon New mRNA codon New amino acid T T G T T C This would be an example of which type of a point mutation?__________________________

Now imagine that a mutation occurred at the first G in the DNA sequence above and the G became a C. How would this affect the mRNA and the amino acid for that codon? Old DNA codon Old RNA codon Old amino acid New DNA codon New mRNA codon New amino acid T T G T T C This would be an example of which type of a point mutation?__________________________

Name: Now imagine that a mutation occurred at the first G in the DNA sequenc
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Now imagine that a mutation occurred at the first G in the DNA sequence above and the G became a C. How would this affect the mRNA and the amino acid for that codon?Old DNA codonOld RNA codonOld amino acidNew DNA codonNew mRNA codonNew amino acidT T

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Similar questions

Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
Now imagine that a mutation occurred in the g of the codon below and the G became a C. How would this affect the mRNA and the amino acid for that codon? Old DNA codon Old RNA codon Old amino acid New DNA codon New mRNA codon New amino acid A T G A T C This would be an example of which type of a point mutation?__________________________
Now imagine that a mutation occurred in the second T of the codon below and the T became a G. How would this affect the mRNA and the amino acid for that codon? Old DNA codon Old RNA codon Old amino acid New DNA codon New mRNA codon New amino acid T T G T G G This would be an example of which type of a point mutation?__________________________
Finally, imagine that a mutation occurred in the codon below and an A was inserted between the two Ts. How would this affect the mRNA and the amino acid for that codon? Old DNA codon Old RNA codon Old amino acid New DNA codon New mRNA codon New amino acid T T G T A T G This would be an example of which type of a mutation?__________________________
(a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGCGUUUAAGGACGGUA 3' Amino acids - (Asp Leu Pro Arg Leu Arg Thr Val) (b.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGGAAATCCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGCCUUUAGGGACGGUA 3' Amino acids - (Asp Leu Pro Pro Leu Gly Thr Val) (c.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCTCAAATCCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGAGUUUAGGGACGGUA 3' Amino acids - (Asp Leu Pro Ser Leu Gly Thr Val) (d.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATCCCTCCAT 3¹ Then the mRNA sequence will be, 5' GAUAUUCCGCGUUUAGGGAGGUA 3' Amino acids - (Asp Leu Pro Arg Leu Gly Arg).As the last sequence contains only 2 bases it will not represent any amino acid. question: Choose the types of mutations caused by the changes in parts…
Shown below is a DNA coding strand. A base (*G*) mutates to Adenine (A). What will be the resulting amino acid sequence as a result of the mutation? What type of mutation occured? Hint: Determine the template, then first determine the amino acid sequence before the mutation, and then determine the amino acid sequence after the mutation. Show how you got your answer. 5' T-A-C-T-T-C-C-A-*G*-C-C-G-C-T-C 3'
A gene is a piece of DNA that codes for a protein. Genes are transcribed into mRNA and are on the antisense strand of DNA. A gene contains the following nucleotide sequence: TAC GGC ACC GTA ATT If the following changes occurred in the gene, identify the type of mutation and how it would affect the protein made (amino acid) Changes: Second codon change from GGC to AGC Third adenine base changed to a guanine base Ninth nucleotide changes from C to T Nucleotide with adenine (A) base inserted between 3rd and 4th nucleotide
If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTT
DNA Sequence: TAC TCC GGC TCT CCC AGT TGA ACT Mutated Sequence: TAC TCG GCT CTC CCA GTT GAA CT Original Amino acid: Mutated Amino Acid: What mutation have occurred in the sequence? How does it affect the expression of amino acids? 2. DNA Sequence: TAC TCC GGC TCT CCC AGT TGA ACT Mutated Sequence: TAC TCT GGC TCT CCA AGT TGA ACT Original Amino acid: Mutated Amino Acid: What mutation has occurred in the sequence? How does it affect the expression of amino acids? 3. DNA Sequence: TAC TCC GGC TCT CCC AGT TGA ACT Mutated Sequence: TAC TCC GGC TCT CCC ACT TGA ACT Original Amino acid: Mutated Amino Acid: What type of mutation has occurred in the sequence? How does it affect the expression of amino acids? 4. DNA Sequence: TAC TCC GGC TCT CCC AGT TGA ACT Mutated Sequence: TAC TCC GGC TCG CCC ACT TGA ACT Original Amino acid: Mutated Amino Acid: What of mutation mutation has occurred in the sequence? How…
Below is a segment of RNA, transcribed from a DNA sequence. Provide an example of each kind of mutation and explain what will happen to the organism. You may choose which base to alter. Please provide the new amino acid sequence with each mutation. 5’ AUGCCUACGGACUGGCCU 3’ (Met/Pro/Thr/Asp/Trp/Pro) Use the following codon chart to help you show the translation of each sequence. a. Frameshift Mutation : b. Missense Mutation : c. Silent Mutation : d. What is the anticodon sequence of the original amino acid?
Identify the type of mutation and how it would affect the protein made (amino acid) if the following changes occurred in the DNA template strand.DNA Strand: TCT AAC TAT CCC CTA Third codon change from TAT to TAG. Second codon change from AAC to ATC. Nucleotide with adenine (A) base inserted between 14th and 15th nucleotide. Ninth nucleotide changes from T to C. Types of Mutation Changes in the Amino Acid 1. 2. 3. 4.
Use this mRNA coding sequence as your starting point. This sequence begins with a start codon and ends with a stop codon, so it is only looking at the region of DNA that directly encodes a protein sequence. 5’-AUGCACAAAUUAGAGUACCCCCCAGGAAGGUAG-3’ Make the following mutation in this sequence by changing/adding/removing only one nucleotide. Make the mutation easy to see (a different color, circled, something like that) 1) A silent mutation that is also a transition