A mutation occurred that changes the sequence of DNA from: 5’ACGTCATGGATAGTGCGTAAACTA3’ to 5’ACGTCATGCGATAGTGCGTAAACTA3’ Describe the effect of this mutation on the protein, and give the name of the type of mutation.

Q: Under what condition(s) will a single base change in a gene will not cause mutation in the protein

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: Compare the two DNA sequences shown below and consider the single nucleotide mutation made in the…

A: Quality transformations include adjustment in the construction of qualities which changes or alters…

Q: AGGTATCGCAT is a sequence from the coding strand of a gene. What will bw the corresponding sequence…

A: The terms used in the question represents the molecules used during a gene expression. A gene is a…

Q: Given below is a DNA sequence as well as its corresponding mRNA and protein amino acid sequences.…

A: Mutation basically refers to the random change in the DNA sequence. These changes can result in a…

Q: If the DNA sequence is ATG-CGT, the mRNA codons are ___.   ATG-CGT   UAC-GCA   GUA-CGU   AUG-CGU…

A: DNA full form is deoxyribonucleic acid. DNA is the main constituent of the chromosome. It contains…

Q: A mutation occurred in the DNA sequence during replication. Which of the following, A-D, describes…

A: A mutation occurs when the nucleotide sequence of an organism, virus, or extra - chromosomal DNA is…

Q: transcribed RNA

A: Transcription is the process of copying a segment of DNA into RNA. Only one of the two DNA strands…

Q: If the base sequence of template strand reads GCCATTAC, what is the base sequence of the mRNA? O A)…

A:

Q: The mRNA sequence AUG CAC AGU codes for the first three amino acids of a particular protein. Which…

A: The mRNA synthesized after transcription process undergoes translation to synthesize proteins. The…

Q: Chargaff's Rule states that adenine is paired with and cytosine is paired with

A: The rule that in DNA, the bases A and T are always equal in amount, and the bases G and C are always…

Q: If the template strand of DNA has the sequence 5'AATGCCTATA3', the MRNA sequence that is transcribed…

A: Transcription is the first of several steps in gene expression in which a particular segment of DNA…

Q: Compare the severity of DNA mutations that produce the following changes in mRNA codons:(a) GCU to…

A: The genetic material is transferred to the next generation through reproduction. The sequence of the…

Q: The template strand of DNA is 3’AGGATGCACGTAC5’ The sequence of the mRNA that is made from this DNA…

A: The RNA sequence would be same as coding strand (except thiamine is replaced by uracil) and opposite…

Q: Some mutations affect changes in protein structure and function that can result in disease whereas…

A: The DNA (deoxyribonucleic acid) is the genetic material of an organism. The DNA is inherited by the…

Q: Classify the type of mutation that have taken place: silent, missense and nonsense as a result of a…

A: The mutation occurs when there is a change in the nucleic acid sequence. These mutations could be…

Q: Select the correct complementary strand of DNA for the following DNA sequence ATG GGG CGG ATA TAC…

A: Deoxyribonucleic acid, better known as DNA, is a major gene for most of life. Some viruses use…

Q: A mutation to a tRNA with the anticodon of AGG changes the amino acid bound to the TRNA from serine…

A: Mutation refers to alterations in the DNA sequence. These alterations can either be produced due to…

Q: Based on one strand of a certain segment of DNA with the sequence below, answer the following…

A: DNA and RNA are major bio molecules found in the body. They help in transferring the information…

Q: A gene contains the sequence GGCTAAC. What is the sequence of the MRNA transcribed from this strand…

A: The method of producing an RNA copy of a gene sequence is known as transcription. This duplicate,…

Q: Gene mutations ultimately alter protein structure. In whichregion of a carrier protein would a…

A: Protein structures are translated from the DNA present in the nucleus of the cell. DNA will be…

Q: 5’GCTATAAAGCGTATCGCGTCATA 3

A: Complementary mRNA      5’GCT ATA AAG CGT ATC GCG TCA TA '3     3'CGA UAU UUC GCA UAG CGC AGU AU '5

Q: explain why a mutation in the dna nucleotide sequence that corresponds to the 3rd nitrogen base in…

A: A mutation is a change that occurs in our DNA sequence, either due to mistakes when the DNA is…

Q: Which of the following mutations of the DNA sequence TTT TÁC ÁCT would potentially have the least…

A: The genetic information from the DNA is first transcribed into mRNA. The mRNA contains codons, which…

Q: Which is the DNA template given if the MRNA is 3- CGGAUGCCCGUAUAC -5 ? O 3- GCCTACGGGCATATG-5 O 5-…

A: The common rule of Base pairing in DNA is: A pairs with T by a double bond and G pairs with C by a…

Q: name one kind of mutation that produces an altered protein. what determines wether the altered…

A: Genetic material is nothing but the sequence of nucleic acids which is called as DNA. It contains…

Q: A non-coding DNA strand has the sequence below: GTACCGATATAATCGGGCTA What is the MRNA sequence that…

A: Noncoding DNA sequences are DNA sequences that do not encode protein sequences in an organism.…

Q: Describe the effect of the substitution mutation in a sequence of amino acids.

A: Mutation is defined as a change in the sequence of DNA that occurs as a result of DNA copying errors…

Q: Describe the effect on the protein if the base pair #6 in the parent DNA chain is misted from G/C to…

A: Deoxyribonucleic acid (DNA) is the foremost key genetic constituent of all life forms. It is further…

Q: 3. 3' CTT TCT TGT AGT TẠC CGG GTA GAA TAG TTG CTG ACT 5'

A: DNA is the genetic material of most living organisms. The DNA is inherited from the parents and it…

Q: Compare and contrast nonsense mutations, silent mutations, and missense mutations including the…

A: Muttations are the phenomenon in which one or more base pairs are affected or change in the…

Q: A proteih was Which of the following mutations will least effect the protein's function? a) A…

A: If a point mutation does not produce any change in the the amino acid, it's called a SILENT…

Q: If the first G changes to A what kind of mutation will happen? Show the change in amino acid…

A: When there is an error in the DNA sequence during replication it causes a change in the DNA…

Q: What is the sequence of bases in the template strand of DNA that codes for the mRNA in Problem?

A: The sequence of mRNA given in the problem is 5'AAA GUU GGC UAC CCC GGA AUG GUG GUC 3' and the…

Q: Why is a mutation of a base in a DNA sequence much more serious than a mutation in a transcribed…

A: Replication is considered as the process, during which DNA is replicated into DNA, which is after…

Q: Define the silent mutation in DNA

A: Mutation occurs due to sudden change in DNA structure and sequence which results in either gain or…

Q: If the nucleotide at position 23 in thw first strand of DNA ia changed to "A", what effect would…

A: The change in the nucleotide sequence can occur due to the mutation in the gene expression. These…

Q: A G C A A T C C G T C T T G G T C G T T A G G C A G A A C C That strand has mutated. It is now A…

A: Mutation  A change in the sequence of DNA bases that may or may not causes serious problem in an…

Q: Finally, imagine that a mutation occurred in the codon below and an A was inserted between the two…

A: a mutation occurred in the codon below and an A was inserted between the two Ts T  T  G chnages to T…

Q: Give the mRNA and amino acid sequence from this DNA strand: CCATTAACCTTACTGCTGGCTAAATTCGTTGCT

A: DNA => Transcription => mRNA => Translation => Protein Given a sequence of DNA:…

Q: 6. If the first G changes to A what kind of mutation will happen? Show the change in amino acid…

A: Introduction :- A mutation occurs when the sequence of DNA changes. Mutations can occur as a result…

Q: Using the chart below, what type of mutation would take place if the highlighted and underlined "A"…

A: DNA is the carrier of genetic information in almost all organisms except for certain RNA viruses.…

Q: Select the best answer or answers from the choices given: If DNA has a sequence of AAA, then a…

A: The nucleotides are formed by crosslinking three chemicals namely orthophosphoric acid (H3PO4),…

Q: What is the relation of the sequence of the template strand of DNA to the nucleotide sequence of the…

A: The double helix of the DNA gets separated during the process of replication. One strand is known as…

Q: 6. [1] Given the DNA strand, GGACTGATT which of the following is its complementary mRNA? a CCTGACTAA…

A: Transcription Transcription is a process in which the DNA(deoxyribonucleic acid) is transcribed into…

Q: What characteristic of the genetic code explains why a substitution mutation in a codon contained…

A: Codons are sets of three nucleotides responsible for the detection by tRNA for the type of amino…

Q: Sickle cell hemoglobin DNA CACGTAGACTGAGGACAC.. io.. A ... C... Sickle cell hemoglobin MRNA: Sickle…

A: Mutations are the change in the sequence of the DNA. Even a change in single base pair produces…

Q: A mutation leads to a change in one amino acid in a protein. The result is that the protein no…

A: Genome is a dynamic in nature. It is subject to inheritable genetic change. A sudden inheritable…

Q: Define the following terms:a. geneb. mutationc. hydrocarbond. hydrophobice. hydrophilic

A: The plasma membrane of the cell is composed of a bilipid layer with embedded proteins and…

Q: Create the RNA strand to be synthesized from the DNA double strand below and explain this synthesis,…

A: DNA are double helical structures that contains genetic information, which is responsible for almost…

Q: Determine the effect of the following mutations on the DNA sequence. In each case, the mutation is…

A: Any detectable, inheritable qualitative or quantitative change in genetic material of an organism…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.